Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791440
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 155791440
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability.
Proper citation: RRID:RGD_155791440 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156430083
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 156430083
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_156430083 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153344519
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 153344519
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_153344519 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153344518
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 153344518
Notes: This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin RGD HRDP, contact HRDP
Proper citation: RRID:RGD_153344518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155269039
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2022-10-11)
Alternate IDs: 155269039
Notes: PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_155269039 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401799619
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-12)
Alternate IDs: 401799619
Notes: This transgenic strain was created by intracytoplasmic sperm injection (ICSI) mediated DNA transfer. Linearized Acr3-EGFP plasmid DNA (Nakanishi et al., FEBS Lett. 1999; 0.1 micrograms/ml) is mixed with sperm heads of Slc:SD rats for 2 min. The sperm head is microinjected into ovulated oocytes of Slc:SD rat (RGD ID:12910483) and incubated overnight prior to embryo transfer to pseudopregnant females. Resultant pups are examined for correct gene-targeting by genomic PCR, and maintained by crossing the founder with Slc:SD rat. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.
Proper citation: RRID:RGD_401799619 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329812004
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 329812004
Notes: The Wistar rats maintained at The Nencki Institute of Experimental Biology of the Polish Academy of Sciences, Warsaw, Poland
Proper citation: RRID:RGD_329812004 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=404976873
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-03-18)
Alternate IDs: 404976873
Notes: Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected]
Proper citation: RRID:RGD_404976873 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156420152
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 156420152
Notes: This outbred Wistar was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) . National Laboratory Animal Center, Mahidol University Thailand
Proper citation: RRID:RGD_156420152 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=404976871
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2024-03-18)
Alternate IDs: 404976871
Notes: A closed colony of DA/MolTac (RRID:RGD_1566438) has been maintained at the Medical College of Wisconsin for more than 30 generations. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_404976871 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688037
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688037
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688037 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688034
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Live Animals (as of 2017-07-18)
Source References: (null)
Alternate IDs: 5688034
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688034 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855876
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405855876
Notes: This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.
Proper citation: RRID:RGD_405855876 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790615
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryorecovery (as of 2017-02-17)
Alternate IDs: 12790615
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_12790615 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401901202
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 401901202
Notes: The obese SHHFcp/cp are homozygous for the corpulent allele. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait.
Proper citation: RRID:RGD_401901202 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484582
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6484582
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484582 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100226
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100226
Notes: Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).
Proper citation: RRID:RGD_405100226 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401901201
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 401901201
Notes: The lean SHHFcp/+ is heterozygous for the corpulent allele and is the control model for the obese SHHFcp/cp. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait.
Proper citation: RRID:RGD_401901201 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405878047
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 405878047
Notes: D. F. Kohn, Inst. of Comparative Medicine,Columbia University established this strain from institutional albino rats of unknown origin at University of Texas. This HTX is the parent to HTX substrains maintained in other institutions.
Proper citation: RRID:RGD_405878047 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405878046
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 405878046
Notes: This strain derived by Heston 1946 from Buffalo stock of H. Morris, to. It is the parental strains to several BUF substrains maintained in other institutions.
Proper citation: RRID:RGD_405878046 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
