Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054602
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-195(yum2500) II; srh-185(yum2493) srh-186(yum2494) srh-187(yum2495) srh-190(yum2496) srh-192(yum2497) srh-193(yum2498) srh-194(yum2499) srh-199(yum2501) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054602 Copy
http://www.wormbase.org/db/get?name=WBStrain00054607
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054607 Copy
http://www.wormbase.org/db/get?name=WBStrain00054608
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) srh-179(yum2732) srh-180(yum2733) srh-183(yum2736) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054608 Copy
http://www.wormbase.org/db/get?name=WBStrain00054609
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38033425
Synonyms: srh-288(yum2617) srh-289(yum2618) srh-290(yum2619) V
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054609 Copy
http://www.wormbase.org/db/get?name=WBStrain00054551
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: csr-1(fj160); CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054551 Copy
http://www.wormbase.org/db/get?name=WBStrain00054553
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: csr-1(fj163fj150) CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054553 Copy
http://www.wormbase.org/db/get?name=WBStrain00054550
Source Database: WormBase (WB)
Affected Genes: WBGene00001860(him-1)
Genomic Alteration: WBGene00001860(him-1)
Availability: unknown
Source References: PMID:37078421
Synonyms: him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00054550 Copy
http://www.wormbase.org/db/get?name=WBStrain00054555
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: lgc-49(tm6556); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054555 Copy
http://www.wormbase.org/db/get?name=WBStrain00054556
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37500635
Synonyms: acc-3(ok3450); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054556 Copy
http://www.wormbase.org/db/get?name=WBStrain00054540
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-4(ok3124) him-8(e1489) IV
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054540 Copy
http://www.wormbase.org/db/get?name=WBStrain00054541
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-5(tm6207) him-8(e1489) IV
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054541 Copy
http://www.wormbase.org/db/get?name=WBStrain00054542
Source Database: WormBase (WB)
Affected Genes: WBGene00017990(cec-4)|WBGene00017993(cec-5)|WBGene00021913(cec-8)
Genomic Alteration: WBGene00017990(cec-4), WBGene00017993(cec-5), WBGene00021913(cec-8)
Availability: unknown
Source References: PMID:37078421
Synonyms: cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV.
Notes: Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00054542 Copy
http://www.wormbase.org/db/get?name=WBStrain00054548
Source Database: WormBase (WB)
Affected Genes: WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
Source References: PMID:37078421
Synonyms: met-2(ok2307) set-25(n5021) III.
Notes: Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
Proper citation: RRID:WB-STRAIN:WBStrain00054548 Copy
http://www.wormbase.org/db/get?name=WBStrain00054545
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37078421
Synonyms: fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00054545 Copy
http://www.wormbase.org/db/get?name=WBStrain00054547
Source Database: WormBase (WB)
Affected Genes: WBGene00007297(vsra-1)|WBGene00017641(csr-1)
Genomic Alteration: WBGene00007297(vsra-1), WBGene00017641(csr-1)
Availability: unknown
Source References: PMID:37078421
Synonyms: vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV.
Notes: Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Proper citation: RRID:WB-STRAIN:WBStrain00054547 Copy
http://www.wormbase.org/db/get?name=WBStrain00054646
Source Database: WormBase (WB)
Affected Genes: WBGene00001804(gur-3)
Genomic Alteration: WBGene00001804(gur-3)
Availability: unknown
Source References: PMID:38194919
Synonyms: gur-3(ok2245) X; wtfIs5.
Notes: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.|"wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517."
Proper citation: RRID:WB-STRAIN:WBStrain00054646 Copy
http://www.wormbase.org/db/get?name=WBStrain00054696
Source Database: WormBase (WB)
Affected Genes: WBGene00020706(atg-9)
Genomic Alteration: WBGene00020706(atg-9)
Availability: unknown
Source References: EMPTY
Synonyms: atg-9(ola511[delta AP]) V.
Notes: Made_by: InVivo Biosystems|"ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10."
Proper citation: RRID:WB-STRAIN:WBStrain00054696 Copy
http://www.wormbase.org/db/get?name=WBStrain00054692
Source Database: WormBase (WB)
Affected Genes: WBGene00003285(mir-57)|WBGene00003514(myo-2)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00003285(mir-57), WBGene00003514(myo-2), WBGene00005016(sqt-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) II.
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]"
Proper citation: RRID:WB-STRAIN:WBStrain00054692 Copy
http://www.wormbase.org/db/get?name=WBStrain00054735
Source Database: WormBase (WB)
Affected Genes: WBGene00010785(top-2)
Genomic Alteration: WBGene00010785(top-2)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 ers55[top-2::degron::GFP] II.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.|"Made_by: Ana Morao"
Proper citation: RRID:WB-STRAIN:WBStrain00054735 Copy
http://www.wormbase.org/db/get?name=WBStrain00054699
Source Database: WormBase (WB)
Affected Genes: WBGene00000962(dhc-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000962(dhc-1), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III.
Notes: ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
Proper citation: RRID:WB-STRAIN:WBStrain00054699 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.