Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 94 showing 1861 ~ 1880 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00005107

http://www.wormbase.org/db/get?name=WBStrain00005107

Source Database: WormBase (WB)
Affected Genes: WBGene00003515(myo-3)
Genomic Alteration: WBGene00003515(myo-3)
Availability: unknown
Source References: EMPTY
Synonyms: dvIs47.
Alternate IDs: WB-STRAIN:CL2392
Notes: dvIs47 [myo-3p::HSP-16.2 + mtl-2p::GFP]. Integrated transgenic strain with constitutive body wall muscle expression of the small heat shock protein HSP-16.2 marked by co-injection of intestinally-expressed mtl-2p::GFP.

Proper citation: RRID:WB-STRAIN:WBStrain00005107 Copy   


  • RRID:WB-STRAIN:WBStrain00005104

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005104

Source Database: WormBase (WB)
Availability: available
Source References: PMID:35018947, PMID:37549461, PMID:37239029, PMID:38983916
Synonyms: dvIs37.
Alternate IDs: WB-STRAIN:CL2331, CGC_CL2331
Notes: dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.|"expresses the human A3-42 peptide fused to green fluorescent protein (GFP) in its body-wall muscle cells"|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00005104 Copy   


  • RRID:WB-STRAIN:WBStrain00005105

http://www.wormbase.org/db/get?name=WBStrain00005105

Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: EMPTY
Synonyms: smg-1(cc546) I; dvIs38.
Alternate IDs: WB-STRAIN:CL2337, CGC_CL2337
Notes: dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00005105 Copy   


  • RRID:WB-STRAIN:WBStrain00005102

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005102

Source Database: WormBase (WB)
Affected Genes: WBGene00001752(gst-4)
Genomic Alteration: WBGene00001752(gst-4)
Availability: available
Source References: PMID:12757851, PMID:29956725, PMID:31409866, PMID:31432005, PMID:31510078, PMID:31717869, PMID:31735670, PMID:32294300, PMID:32600387, PMID:33008901, PMID:32163353, PMID:33471780, PMID:33789349, PMID:33809299, PMID:33883621, PMID:34505574, PMID:35602005, PMID:36791646, PMID:37099597, PMID:37416472, PMID:37427543, PMID:37488107, PMID:37549461, PMID:37606250, PMID:37726773, PMID:37751046, PMID:37902464, PMID:37910615, PMID:38632209, PMID:38799567, PMID:38754743, PMID:38889876, PMID:38983916, PMID:38991033, PMID:39169052, PMID:39164296, PMID:39264947, PMID:39097626, PMID:39420966, PMID:39561954, PMID:39560153
Synonyms: dvIs19 [(pAF15)gst-4p::GFP::NLS] III.
Alternate IDs: WB-STRAIN:CL2166, CGC_CL2166
Notes: dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057197 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (dvIs19[pAF15(gst-4::GFP::NLS)])"|"Supplementary_genotype dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype dvIs19[(pAF15)gst-4p::GFP::NLS]"|"Supplementary_genotype gst-4::GFP dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype gst-4p::GFP"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005102 Copy   


  • RRID:WB-STRAIN:WBStrain00005103

http://www.wormbase.org/db/get?name=WBStrain00005103

Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: EMPTY
Synonyms: smg-1(cc546) I; dvIs179.
Alternate IDs: WB-STRAIN:CL2179, CGC_CL2179
Notes: dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00005103 Copy   


  • RRID:WB-STRAIN:WBStrain00005122

http://www.wormbase.org/db/get?name=WBStrain00005122

Source Database: WormBase (WB)
Affected Genes: WBGene00001648(goa-1)
Genomic Alteration: WBGene00001648(goa-1)
Availability: available
Source References: PMID:34622282
Synonyms: goa-1(knu751) I.
Alternate IDs: WB-STRAIN:COP1863, CGC_COP1863
Notes: Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"|"WBStrain provided so WBPaper00062031 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005122 Copy   


  • RRID:WB-STRAIN:WBStrain00005123

http://www.wormbase.org/db/get?name=WBStrain00005123

Source Database: WormBase (WB)
Affected Genes: WBGene00011352(rskn-1)
Genomic Alteration: WBGene00011352(rskn-1)
Availability: available
Source References: EMPTY
Synonyms: rskn-1(knu796) I.
Alternate IDs: WB-STRAIN:COP1918, CGC_COP1918
Notes: Made_by: NemaMetrix|"Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information."

Proper citation: RRID:WB-STRAIN:WBStrain00005123 Copy   


  • RRID:WB-STRAIN:WBStrain00005120

http://www.wormbase.org/db/get?name=WBStrain00005120

Source Database: WormBase (WB)
Affected Genes: WBGene00003561(ncr-1)
Genomic Alteration: WBGene00003561(ncr-1)
Availability: available
Source References: EMPTY
Synonyms: ncr-1(knu4) X.
Alternate IDs: WB-STRAIN:COP677, CGC_COP677
Notes: Cholesterol-sensitive. Smaller broods and sizes upon serial cholesterol deprivation. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"

Proper citation: RRID:WB-STRAIN:WBStrain00005120 Copy   


  • RRID:WB-STRAIN:WBStrain00005119

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005119

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37039075, PMID:37118512
Synonyms: unc-119(ed3) III; knuSi221.
Alternate IDs: WB-STRAIN:COP262, CGC_COP262
Notes: fib-1 translational marker|"knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43."|"Made_by: Knudra Transgenics"

Proper citation: RRID:WB-STRAIN:WBStrain00005119 Copy   


  • RRID:WB-STRAIN:WBStrain00005117

http://www.wormbase.org/db/get?name=WBStrain00005117

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CM117
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005117 Copy   


  • RRID:WB-STRAIN:WBStrain00005115

http://www.wormbase.org/db/get?name=WBStrain00005115

Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004804(skn-1), WBGene00004879(smg-1)
Availability: available
Source References: EMPTY
Synonyms: smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X.
Alternate IDs: WB-STRAIN:CL6180, CGC_CL6180
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00005115 Copy   


  • RRID:WB-STRAIN:WBStrain00005114

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005114

Source Database: WormBase (WB)
Availability: available
Source References: PMID:37957360, PMID:39212733
Synonyms: dvIs62 X.
Alternate IDs: WB-STRAIN:CL6049, CGC_CL6049
Notes: Associated protein: Human TDP-43|"dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18."|"Mutagen:UV/TMP"|"Supplementary_genotype dvIs62 [snb-1p::hTDP-43/3'long UTR + mtl-2p::GFP] X"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"

Proper citation: RRID:WB-STRAIN:WBStrain00005114 Copy   


  • RRID:WB-STRAIN:WBStrain00005134

http://www.wormbase.org/db/get?name=WBStrain00005134

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22723984
Synonyms: nlg-1 (ok259) X; crrEx3 [pPD95.77 (Pnlg-1::NLGN-1); pDD04NeoR(Pmyo-2::GFP)].
Alternate IDs: WB-STRAIN:CRR103
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005134 Copy   


  • RRID:WB-STRAIN:WBStrain00005131

http://www.wormbase.org/db/get?name=WBStrain00005131

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:20010541
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CRR21
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005131 Copy   


  • RRID:WB-STRAIN:WBStrain00005132

http://www.wormbase.org/db/get?name=WBStrain00005132

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:20010541
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CRR23
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005132 Copy   


  • RRID:WB-STRAIN:WBStrain00005130

http://www.wormbase.org/db/get?name=WBStrain00005130

Source Database: WormBase (WB)
Affected Genes: WBGene00006412(nlg-1)
Genomic Alteration: WBGene00006412(nlg-1)
Availability: unknown
Source References: PMID:22723984
Synonyms: nlg-1(tm474) X.
Alternate IDs: WB-STRAIN:CRR2
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005130 Copy   


  • RRID:WB-STRAIN:WBStrain00005126

http://www.wormbase.org/db/get?name=WBStrain00005126

Source Database: WormBase (WB)
Affected Genes: WBGene00011050(agl-1)
Genomic Alteration: WBGene00011050(agl-1)
Availability: available
Source References: EMPTY
Synonyms: agl-1(knu864) II.
Alternate IDs: WB-STRAIN:COP2008, CGC_COP2008
Notes: Made_by: NemaMetrix|"Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information."

Proper citation: RRID:WB-STRAIN:WBStrain00005126 Copy   


  • RRID:WB-STRAIN:WBStrain00005124

http://www.wormbase.org/db/get?name=WBStrain00005124

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: K09E4.4(knu858) II.
Alternate IDs: WB-STRAIN:COP2002, CGC_COP2002
Notes: knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"

Proper citation: RRID:WB-STRAIN:WBStrain00005124 Copy   


  • RRID:WB-STRAIN:WBStrain00005144

http://www.wormbase.org/db/get?name=WBStrain00005144

Source Database: WormBase (WB)
Affected Genes: WBGene00004862(sma-9)
Genomic Alteration: WBGene00004862(sma-9)
Availability: available
Source References: EMPTY
Synonyms: sma-9(qc3) X.
Alternate IDs: WB-STRAIN:CS67, CGC_CS67
Notes: Small body size. Crumpled spicules. Male ray 8-9 fusion.

Proper citation: RRID:WB-STRAIN:WBStrain00005144 Copy   


  • RRID:WB-STRAIN:WBStrain00005145

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005145

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004857(sma-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004857(sma-3)
Availability: available
Source References: EMPTY
Synonyms: sma-3(wk30) III; him-5(e1490) V; qcEx24.
Alternate IDs: WB-STRAIN:CS119, CGC_CS119
Notes: qcEx24 [GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.

Proper citation: RRID:WB-STRAIN:WBStrain00005145 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X