Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00037056

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00020094(wip-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020094(wip-1)
Availability: available
Synonyms: wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2053, CGC_VC2053
Notes: R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037056 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037034

Source Database: WormBase (WB)
Affected Genes: WBGene00001461(flp-18)
Genomic Alteration: WBGene00001461(flp-18)
Availability: available
Synonyms: flp-18(gk3063) X.
Alternate IDs: WB-STRAIN:VC2016, CGC_VC2016
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA."

Proper citation: RRID:WB-STRAIN:WBStrain00037034 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037194

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018152(acs-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018152(acs-4)
Availability: available
Source References: PMID:37164154
Synonyms: acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2240, CGC_VC2240
Notes: F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037194 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037154

Source Database: WormBase (WB)
Affected Genes: WBGene00019125(ddl-1)
Genomic Alteration: WBGene00019125(ddl-1)
Availability: available
Synonyms: ddl-1(ok2916) II.
Alternate IDs: WB-STRAIN:VC2193, CGC_VC2193
Notes: F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC.|"F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGATTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGTGTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037154 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037158

Source Database: WormBase (WB)
Affected Genes: WBGene00004860(sma-6)
Genomic Alteration: WBGene00004860(sma-6)
Availability: available
Synonyms: sma-6(ok2894) II.
Alternate IDs: WB-STRAIN:VC2197, CGC_VC2197
Notes: C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037158 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037157

Source Database: WormBase (WB)
Affected Genes: WBGene00011737(sqst-1)
Genomic Alteration: WBGene00011737(sqst-1)
Availability: available
Synonyms: T12G3.1(ok2892) IV.
Alternate IDs: WB-STRAIN:VC2196, CGC_VC2196
Notes: Made_by: Vancouver KO Group|"T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037157 Copy   

•   Source: WormBase
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL1980

Source Database: Zebrafish Lines at ZIRC
Affected Genes: clom39
Genomic Alteration: m39
Availability: frozen
Notes: Deficiency

Proper citation: RRID:ZIRC_ZL1980 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL2155

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: gata1am651/+ (AB)
Genomic Alteration: m651
Availability: frozen
Notes: Allele with one point mutation

Proper citation: RRID:ZIRC_ZL2155 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL2773

Source Database: Zebrafish Lines at ZIRC
Affected Genes: nrp2bmn0126Gt
Genomic Alteration: mn0126Gt
Availability: frozen *
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL2773 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL10089

Source Database: Zebrafish Lines at ZIRC
Affected Genes: -nc1Tg
Genomic Alteration: nc1Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL10089 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL9916

Source Database: Zebrafish Lines at ZIRC
Affected Genes: -pd41Tg
Genomic Alteration: pd41Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL9916 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL9917

Source Database: Zebrafish Lines at ZIRC
Affected Genes: -pd42Tg
Genomic Alteration: pd42Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL9917 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL9918

Source Database: Zebrafish Lines at ZIRC
Affected Genes: -pd45Tg
Genomic Alteration: pd45Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL9918 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL1747

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: nl1Tg/+ (AB)
Genomic Alteration: nl1Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL1747 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL14378

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: -pd10Tg (AB)
Genomic Alteration: pd10Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL14378 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL1088

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: rk8Tg/+ (AB)
Genomic Alteration: rk8Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL1088 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL10385

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: -pd51Tg (AB)
Genomic Alteration: pd51Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL10385 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL1197

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: s843Tg/+ (AB)
Genomic Alteration: s843Tg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL1197 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL9731

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: s356tTg/+ (AB)
Genomic Alteration: s356tTg
Availability: frozen
Notes: Transgenic Insertion

Proper citation: RRID:ZIRC_ZL9731 Copy   

•   Source: Zebrafish International Resource Center
  

http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL11101

Source Database: Zebrafish Lines at ZIRC
Genetic Background: AB
Affected Genes: irx1asa15451 (AB)
Genomic Alteration: sa15451
Availability: frozen
Notes: Allele with one point mutation

Proper citation: RRID:ZIRC_ZL11101 Copy   

•   Source: Zebrafish International Resource Center