Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00059085
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37934770
Synonyms: jsSi1579 jsSi1606 [unc-116(+)] II; unc-116(udn42) III
Notes: T90T with extra copy unc-116
Proper citation: RRID:WB-STRAIN:WBStrain00059085 Copy
http://www.wormbase.org/db/get?name=WBStrain00059083
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37934770
Synonyms: unc-116(udn44)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III
Notes: Variant-edited allele T90I #1.
Proper citation: RRID:WB-STRAIN:WBStrain00059083 Copy
http://www.wormbase.org/db/get?name=WBStrain00059524
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38266092
Synonyms: dmaIs125 [tsp-1p::tsp-1::GFP; unc-54p::mCherry]
Notes: [2024-06-07T13:18:34.611Z WBPerson51134] New Strain: WBPaper00066419, dmaIs125 [tsp-1p::tsp-1::GFP; unc-54p::mCherry], DMS1857, C.elegans.
Proper citation: RRID:WB-STRAIN:WBStrain00059524 Copy
http://www.wormbase.org/db/get?name=WBStrain00052743
Source Database: WormBase (WB)
Availability: available
Source References: PMID:35636511
Synonyms: risIs33; gpIs1.
Alternate IDs: CGC_MIR276
Notes: Made_by: Anita Goyala|"risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375."|"[2023-02-01T19:52:34.889Z WBPerson712] New Strain: MIR276, risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]; gpIs1 [hsp-16.2p::GFP] WBPaper00064116 identifier : pmid35636511"
Proper citation: RRID:WB-STRAIN:WBStrain00052743 Copy
http://www.wormbase.org/db/get?name=WBStrain00052822
Source Database: WormBase (WB)
Affected Genes: WBGene00015248(mai-2)
Genomic Alteration: WBGene00015248(mai-2)
Availability: unknown
Source References: PMID:28829773, PMID:38446666
Synonyms: xmSi[mai-2::gfp]
Notes: Growth temperature 24 degC|"[2023-06-14T13:30:32.421Z WBPerson51134] New Strain: WBPaper00052941, Genotype [Pmai-2::mai-2::GFP::mai-2 3UTR; unc-119(+)];xmSi01"
Proper citation: RRID:WB-STRAIN:WBStrain00052822 Copy
http://www.wormbase.org/db/get?name=WBStrain00052850
Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: PMID:37746064
Synonyms: egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV.
Alternate IDs: CGC_GLW53
Notes: Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.|"Made_by: Kara McDonald (Glow Worms '21)"|"[2023-06-29T19:05:01.936Z WBPerson712] New Strain: WBPaper00065588 GLW53 egl-19(utx45[egl-19(ab1-33)::mScarlet::3xMyc::egl-19(ab34-)] IV Referred to herein as mScarlet::EGL-19(ab). Internal mScarlet tag at the 5 end of exon 3 that tags isoforms a and b. The insertion was verified by PCR and fluorescence. Left flank: 5 ttatttgaatgagcaaaaaataaatttcag 3; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60. Strain available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00052850 Copy
http://www.wormbase.org/db/get?name=WBStrain00052849
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37746064
Synonyms: EMPTY
Notes: [2023-06-29T19:03:36.67Z WBPerson712] New Strain: WBPaper00065588 (1) AG463 egl-19(av264[egl-19(abc)::GFP]) IV Referred to herein as EGL-19(abc)::GFP. C-terminal GFP tag of all isoforms of EGL-19. crRNA: 5 AAGAATCTTCTGGAAGATGA 3; Repair template fwd primer: 5 GATCACAAGAAGATCTACTTTTAGTTACAACTCTTGGAGCATCGGGAGCCtcagg 3; Repair template rev primer: 5 gttttttttgtggtgagaagaatcttctggaagatgatagttcTCACTTGTAGAGCTCGTCCATTC 3. The repair template was amplified from plasmid pDD282. Strain available by request.
Proper citation: RRID:WB-STRAIN:WBStrain00052849 Copy
http://www.wormbase.org/db/get?name=WBStrain00053178
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37186867
Synonyms: rimb-1(ce828); unc-10(md1117); unc-2(cim104)[gfp::unc-2]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053178 Copy
http://www.wormbase.org/db/get?name=WBStrain00053180
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37186867
Synonyms: cla-1(wy1048); elks-1(cim121)[elks-1::gfp]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053180 Copy
http://www.wormbase.org/db/get?name=WBStrain00053276
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37070766
Synonyms: lst-1(q1125) I; ntl-1(q1244) [3XFLAG] glp-1(ar202) III
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053276 Copy
http://www.wormbase.org/db/get?name=WBStrain00053274
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37070766
Synonyms: lst-1(q1265) I; qSi375 II
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053274 Copy
http://www.wormbase.org/db/get?name=WBStrain00053279
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36652499
Synonyms: odr-7(ky4) X
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053279 Copy
http://www.wormbase.org/db/get?name=WBStrain00053250
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37070766
Synonyms: puf-11(q1128) [puf-11::3xV5] IV
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053250 Copy
http://www.wormbase.org/db/get?name=WBStrain00053251
Source Database: WormBase (WB)
Affected Genes: WBGene00003083(lst-1)|WBGene00012104(sygl-1)
Genomic Alteration: WBGene00003083(lst-1), WBGene00012104(sygl-1)
Availability: unknown
Source References: PMID:37070766
Synonyms: lst-1(q1004[lst-1::3xV5]) sygl-1(q828) I.
Notes: 3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus.|"Made_by: A. Enright"
Proper citation: RRID:WB-STRAIN:WBStrain00053251 Copy
http://www.wormbase.org/db/get?name=WBStrain00053243
Source Database: WormBase (WB)
Affected Genes: WBGene00003083(lst-1)
Genomic Alteration: WBGene00003083(lst-1)
Availability: unknown
Source References: PMID:37070766
Synonyms: lst-1(q895[lst-1(long)::3xFLAG]) I.
Notes: 3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205|"Made_by: Jon Doenier"
Proper citation: RRID:WB-STRAIN:WBStrain00053243 Copy
http://www.wormbase.org/db/get?name=WBStrain00053451
Source Database: WormBase (WB)
Affected Genes: WBGene00004415(rpl-4)
Genomic Alteration: WBGene00004415(rpl-4)
Availability: unknown
Source References: PMID:37039075
Synonyms: rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I.
Notes: bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3 UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3 UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.|"RPL-4::GFP11 endogenous tag with single copy insertion of GFP1-10 driven by ubiquitous promoter"
Proper citation: RRID:WB-STRAIN:WBStrain00053451 Copy
http://www.wormbase.org/db/get?name=WBStrain00053450
Source Database: WormBase (WB)
Affected Genes: WBGene00004445(rpl-31)
Genomic Alteration: WBGene00004445(rpl-31)
Availability: unknown
Source References: PMID:37039075
Synonyms: bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I.
Notes: bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3 UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3 UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.|"RPL-31::GFP11 endogenous tag with single copy insertion of GFP1-10 driven by ubiquitous promoter"
Proper citation: RRID:WB-STRAIN:WBStrain00053450 Copy
http://www.wormbase.org/db/get?name=WBStrain00053549
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37099601
Synonyms: pw29[nekl-3::aid]; ieSi57[peft-3::mRuby::tir1]; pwls439[GFP::rab-5]
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053549 Copy
http://www.wormbase.org/db/get?name=WBStrain00053918
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37528117
Synonyms: ccIs4251, aceIs1, immt-1(tm1730), ATU3308: ccIs4251, aceIs1, immt-2(tm2366)
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053918 Copy
http://www.wormbase.org/db/get?name=WBStrain00053850
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37746063
Synonyms: EMPTY
Notes: [2023-08-22T22:52:17.256Z WBPerson712] New Strain: The inbred C. nigoni strain CP168, (further inbred from EG5268) was a gift from Eric Haag and Erich Schwarz. WBPaper00065913. 10.17912/micropub.biology.000968
Proper citation: RRID:WB-STRAIN:WBStrain00053850 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
