Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 9 showing 161 ~ 180 out of 1,466 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00063341

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010427(hpo-11)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010427(hpo-11)
Availability: unknown
Source References: EMPTY
Synonyms: hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063341 Copy   


http://www.wormbase.org/db/get?name=WBStrain00063339

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063339 Copy   


http://www.wormbase.org/db/get?name=WBStrain00063371

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003657(nhr-67)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003657(nhr-67)
Availability: unknown
Source References: EMPTY
Synonyms: nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV.
Notes: LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.|"Made_by: Xiao Liu Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00063371 Copy   


http://www.wormbase.org/db/get?name=WBStrain00054622

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00006745(unc-5)|WBGene00021945(lem-4)
Genomic Alteration: WBGene00003514(myo-2), WBGene00006745(unc-5), WBGene00021945(lem-4)
Availability: unknown
Source References: EMPTY
Synonyms: dzDf1 lem-4(ve691[myo-2p::GFP])/tmC25 [unc-5(tm9708)] IV.
Notes: dzDf1 [IV:506328 - 698511 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+ and segregate into dead eggs (dzDf1 homozygotes), wild-type GFP+ (Heterozygotes), and Unc (tmC25 homozygotes).|"Made_by: Leo T. H. Tang"

Proper citation: RRID:WB-STRAIN:WBStrain00054622 Copy   


http://www.wormbase.org/db/get?name=WBStrain00054692

Source Database: WormBase (WB)
Affected Genes: WBGene00003285(mir-57)|WBGene00003514(myo-2)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00003285(mir-57), WBGene00003514(myo-2), WBGene00005016(sqt-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) II.
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]"

Proper citation: RRID:WB-STRAIN:WBStrain00054692 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055431

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055431 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055430

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003964(pdi-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003964(pdi-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055430 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055436

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 3575 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccttgtatcgtccatttgaatgtcatcca ; Right flanking sequence: cagtgaaaaattaagcattagagcggtcaa. sgRNA #1: agtgaattttgtggcggctt; sgRNA #2: atcgtctcaaagctatgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055436 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055435

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 6197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTTGAGATTTAGCAAGTAAATTGAGA ; Right flanking sequence: AGGATAATAATCGTTTTACCAGAGGCAAAG. sgRNA #1: ACGGAGTGTTCTAGGCGTCG; sgRNA #2: GTTTCACATCTCCGTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055435 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055421

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: T01B7.5(ve771[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous early larval arrest. Deletion of 3511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve771 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattgctaatttttggatttcagatacta ; Right flanking sequence: gttgaatgtgtttttgtgtgcccggtcact. sgRNA #1: gaactATGTCATCAAGGAAG; sgRNA #2: cgactaaaagggcaaacgag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055421 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055423

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F13H10.3(ve773[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055423 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055422

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C25F6.7(ve772[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 2402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGTGATTTTTCTATACCCAGTCAGAATT ; Right flanking sequence: AGGTACAACTGGAAGAGATCAGCTTCTAAA. sgRNA #1: TCAGATGACGATCTTCACTA; sgRNA #2: CGCATCAATGGCTGGTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055422 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055429

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: slc-17.2(ve780[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 2131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAATCTTTTCTCCTTCTCTAAGTGGAGC ; Right flanking sequence: CGGTTTGGTAGTAGCCCCTTCCATAATTAT. sgRNA #1: CATCTCATGGCCTTCTTCGG; sgRNA #2: TACTTTACGATCAACTCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055429 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055428

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010769(asah-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010769(asah-1)
Availability: unknown
Source References: EMPTY
Synonyms: asah-1(ve779[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 2292 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAGAATTGTCGGTTTTGTTGCTGGTGGC ; Right flanking sequence: GAGACTTCTCGCTTCGAGACCATCCTTCAA. sgRNA #1: TGTGTGCGCCGCAAAGCATG; sgRNA #2: GACGGACATGAGGACGGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055428 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055425

Source Database: WormBase (WB)
Affected Genes: WBGene00001016(dna-2)|WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001016(dna-2), WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: dna-2(ve776[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
Notes: Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect sterile. Deletion of 3982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that produce sterile progeny (ve776 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatgtctgctgcccgcccgcccgttgcct ; Right flanking sequence: ccttttttactcatttattagatttctcac. sgRNA #1: gattctggctgcgaaatacg; sgRNA #2: cgggaattTTACAGTTGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055425 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055424

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C01A2.4(ve775[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAATCGGAATTTTCCAAGGATGAACATT ; Right flanking sequence: AGGTTTCCAGCACTGCTCCGGCTGATTTCG. sgRNA #1: TTCTCGAAGCCCGATCCAAA; sgRNA #2: TGTCCCTGCTCTTCCCACAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055424 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055427

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018072(nprl-3)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018072(nprl-3)
Availability: unknown
Source References: EMPTY
Synonyms: nprl-3(ve778[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve778 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve780 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055427 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055410

Source Database: WormBase (WB)
Affected Genes: WBGene00000292(cap-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000292(cap-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: cap-1(ve756[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055410 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055414

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y57G11C.33(ve764[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 1238 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgcagtggatcatattcagcctctgctccc ; Right flanking sequence: aggtgcgatatatgttatgttttttttttt. sgRNA #1: ttgtcgatcgtagtgcagag; sgRNA #2: cgatcccttgaatcaaatcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055414 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055413

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006772(unc-36)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006772(unc-36), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: RG KO Group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055413 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X