Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC1228 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036431 | Caenorhabditis elegans | klp-11(tm324) IV. | 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002222(klp-11) | WBGene00002222(klp-11) | WB-STRAIN:WBStrain00036431 | WormBase (WB) | WB | available | PMID:37463209 PMID:38302462 |
WB-STRAIN:VC1228, CGC_VC1228 | 2026-08-15 09:33:10 | 3 | ||
|
VC1230 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036433 | Caenorhabditis elegans | C44H9.4(ok1688) V. | C44H9.4. Superficially wild type. External left primer: GAACAGAATGCGTTCAGCAA. External right primer: AAATCAAAAGACCGGTTTCG. Internal left primer: CTCCAAAACCCCGTCAAGTA. Internal right primer: TTCGGTGTCCTCTTTGGTTT. Internal WT amplicon: 3088 bp. Deletion size: 737 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008099(hzl-1) | WBGene00008099(hzl-1) | WB-STRAIN:WBStrain00036433 | WormBase (WB) | WB | available | WB-STRAIN:VC1230, CGC_VC1230 | 2026-08-15 09:33:10 | 0 | |||
|
VC1233 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036435 | Caenorhabditis elegans | ocr-2(ok1711) IV. | T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003839(ocr-2) | WBGene00003839(ocr-2) | WB-STRAIN:WBStrain00036435 | WormBase (WB) | WB | available | PMID:36652499 | WB-STRAIN:VC1233, CGC_VC1233 | 2026-08-15 09:33:12 | 1 | ||
|
VC1241 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036440 | Caenorhabditis elegans | skr-1(ok1696) I. | F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data." | WBGene00004807(skr-1) | WBGene00004807(skr-1) | WB-STRAIN:WBStrain00036440 | WormBase (WB) | WB | available | PMID:32857970 PMID:38458533 |
WB-STRAIN:VC1241, CGC_VC1241 | 2026-08-15 09:33:10 | 0 | ||
|
VC1251 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036449 | Caenorhabditis elegans | rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00003803(rae-1) | WBGene00000254(bli-4), WBGene00003803(rae-1) | WB-STRAIN:WBStrain00036449 | WormBase (WB) | WB | available | WB-STRAIN:VC1251, CGC_VC1251 | 2026-08-15 09:33:10 | 0 | |||
|
VC1245 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036443 | Caenorhabditis elegans | smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain." | WBGene00000254(bli-4)|WBGene00004873(smc-3) | WBGene00000254(bli-4), WBGene00004873(smc-3) | WB-STRAIN:WBStrain00036443 | WormBase (WB) | WB | available | WB-STRAIN:VC1245, CGC_VC1245 | 2026-08-15 09:33:10 | 0 | |||
|
VC1248 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036446 | Caenorhabditis elegans | gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp." | WBGene00000254(bli-4)|WBGene00013552(gmn-1)|WBGene00013553(Y75B8A.18) | WBGene00000254(bli-4), WBGene00013552(gmn-1), WBGene00013553(Y75B8A.18) | WB-STRAIN:WBStrain00036446 | WormBase (WB) | WB | available | WB-STRAIN:VC1248, CGC_VC1248 | 2026-08-15 09:33:10 | 0 | |||
|
VC1250 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036448 | Caenorhabditis elegans | pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT." | WBGene00000254(bli-4)|WBGene00021636(pcaf-1) | WBGene00000254(bli-4), WBGene00021636(pcaf-1) | WB-STRAIN:WBStrain00036448 | WormBase (WB) | WB | available | WB-STRAIN:VC1250, CGC_VC1250 | 2026-08-15 09:33:10 | 1 | |||
|
VC1249 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036447 | Caenorhabditis elegans | +/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III. | C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00006735(ula-1) | WBGene00001072(dpy-10), WBGene00006735(ula-1) | WB-STRAIN:WBStrain00036447 | WormBase (WB) | WB | available | WB-STRAIN:VC1249, CGC_VC1249 | 2026-08-15 09:33:12 | 0 | |||
|
VC1253 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036451 | Caenorhabditis elegans | cps-6(ok1718) I. | C41D11.8. Superficially wild type. External left primer: TCGTGTTTTTGTTTCCTCCC. External right primer: TTGTTCTGATCGCAGTTGGA. Internal left primer: CCTTTTCCACCTTCCCCTAT. Internal right primer: AAGCTTCGGGTGATTTCTGA. Internal WT amplicon: 2220 bp. Deletion size: 676 bp. Deletion left flank: CCTTCCCCTATTTCGGATGAATTTTTGTTG. Deletion right flank: AGTTACGTGTTTTTGCGAAAAACTTCGTCG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000787(cps-6) | WBGene00000787(cps-6) | WB-STRAIN:WBStrain00036451 | WormBase (WB) | WB | available | WB-STRAIN:VC1253, CGC_VC1253 | 2026-08-15 09:33:10 | 0 | |||
|
VC1351 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036537 | Caenorhabditis elegans | C17E7(gk600) V. | C17E7. Superficially wild type. External left primer: TTGAGGACGGAGTTGCTCTT. External right primer: TCTCCACTGCTTGTTGATCG. Internal left primer: TCCAAATACCGTAGCCCATC. Internal right primer: TCCACCGTCTCTAAGCGAAT. Internal WT amplicon: 1642 bp. Deletion size: 608 bp. Deletion left flank: CGAGGACAACGTGAATATTGCAAAGAGCAA. Deletion right flank: TTTTGTGAGATAAATTGCCTCAACCCTGTA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00036537 | WormBase (WB) | WB | available | WB-STRAIN:VC1351, CGC_VC1351 | 2026-08-15 09:33:14 | 0 | |||||
|
VC1344 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036530 | Caenorhabditis elegans | T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00020383(tin-44) | WBGene00000254(bli-4), WBGene00020383(tin-44) | WB-STRAIN:WBStrain00036530 | WormBase (WB) | WB | available | WB-STRAIN:VC1344, CGC_VC1344 | 2026-08-15 09:33:11 | 0 | |||
|
VC1346 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036532 | Caenorhabditis elegans | F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4) | WBGene00000254(bli-4) | WB-STRAIN:WBStrain00036532 | WormBase (WB) | WB | available | WB-STRAIN:VC1346, CGC_VC1346 | 2026-08-15 09:33:11 | 0 | |||
|
VC1348 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036534 | Caenorhabditis elegans | dnj-19(gk649) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T05C3.5. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 931 bp. Deletion left flank: TAAGGAAATTATAGCCGCAAAGTGCCTCAT. Deletion right flank: CGGCCTGCGAAGCGTCTGGTCTCACATTGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001037(dnj-19) | WBGene00001037(dnj-19) | WB-STRAIN:WBStrain00036534 | WormBase (WB) | WB | available | WB-STRAIN:VC1348, CGC_VC1348 | 2026-08-15 09:33:14 | 0 | |||
|
VC1349 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036535 | Caenorhabditis elegans | nhr-47(gk954) V. | C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003637(nhr-47) | WBGene00003637(nhr-47) | WB-STRAIN:WBStrain00036535 | WormBase (WB) | WB | available | WB-STRAIN:VC1349, CGC_VC1349 | 2026-08-15 09:33:11 | 0 | |||
|
VC1369 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036549 | Caenorhabditis elegans | rpn-10(ok1865) I. | B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA.|"Mutagen:UV/TMP"|"Supplementary_genotype (rpn-10(ok1865) I)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004466(rpn-10) | WBGene00004466(rpn-10) | WB-STRAIN:WBStrain00036549 | WormBase (WB) | WB | available | PMID:37355092 | WB-STRAIN:VC1369, CGC_VC1369 | 2026-08-15 09:33:14 | 3 | ||
|
VC1357 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036541 | Caenorhabditis elegans | H04M03.4(ok1750)/nT1 IV; +/nT1 V. | H04M03.4. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1750 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGGAAATTGTGCCGTTAAT. External right primer: TTTTGCGAATTTTTCATCCC. Internal left primer: AATGTTTCAGGAGGCCATTG. Internal right primer: TATCCCCGTGGAATAGTTGG. Internal WT amplicon: 3042 bp. Deletion size: 1376 bp. Deletion left flank: AGAAGTTGCCAAATGAGTGGTTCAAGTTCA. Deletion right flank: TATATGTGCTATATAATTCTCATAATTTCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019154(glf-1) | WBGene00019154(glf-1) | WB-STRAIN:WBStrain00036541 | WormBase (WB) | WB | available | WB-STRAIN:VC1357, CGC_VC1357 | 2026-08-15 09:33:12 | 0 | |||
|
VC1356 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036540 | Caenorhabditis elegans | nhr-214(gk604) X. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T07C5.3. Superficially wild type. External left primer: TTCGCATAGGATTGTTGCAG. External right primer: GGTTGGCTTCTGCAGTTTTC. Internal left primer: GTTTGTTCTCACTGGACGCA. Internal right primer: ATCACAACGACCGGCTATTC. Internal WT amplicon: 1847 bp. Deletion size: 337 bp. Deletion left flank: CGATTGAAACGAGACGTTGGAAAATTAGTA. Deletion right flank: TGCTCCTTTGAAAAAGTATTTCAAATCTTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011566(nhr-214) | WBGene00011566(nhr-214) | WB-STRAIN:WBStrain00036540 | WormBase (WB) | WB | available | WB-STRAIN:VC1356, CGC_VC1356 | 2026-08-15 09:33:14 | 0 | |||
|
VC1360 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036543 | Caenorhabditis elegans | Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC." | WBGene00000254(bli-4) | WBGene00000254(bli-4) | WB-STRAIN:WBStrain00036543 | WormBase (WB) | WB | available | WB-STRAIN:VC1360, CGC_VC1360 | 2026-08-15 09:33:14 | 0 | |||
|
VC1362 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036545 | Caenorhabditis elegans | taf-11.1(gk648) X. | F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 794 bp. Deletion left flank: TACCAAGCATTGATTCAACAACATCAGCCG. Deletion right flank: ATATAATCAGATTCTAATGAAAAAAAGTAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006393(taf-11.1) | WBGene00006393(taf-11.1) | WB-STRAIN:WBStrain00036545 | WormBase (WB) | WB | available | WB-STRAIN:VC1362, CGC_VC1362 | 2026-08-15 09:33:12 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
