Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
EG3027 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006678 | Caenorhabditis elegans | unc-26(s1710) IV. | Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping. | WBGene00006763(unc-26) | WBGene00006763(unc-26) | WB-STRAIN:WBStrain00006678 | WormBase (WB) | WB | available | PMID:35065714 PMID:37053235 |
WB-STRAIN:EG3027, CGC_EG3027 | WormBase | 2026-10-10 10:51:25 | 1 | ||
|
ED3011 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006618 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006618 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3011, CGC_ED3011 | WormBase | 2026-10-10 10:51:24 | 1 | ||||
|
EG4725 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006698 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00006698 | WormBase (WB) | WB | available | PMID:22301316 PMID:33593818 PMID:33820969 PMID:38564369 PMID:39303031 PMID:39853894 |
WB-STRAIN:EG4725, CGC_EG4725 | WormBase | 2026-10-10 10:51:25 | 2 | ||||
|
ED3017 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006622 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006622 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3017, CGC_ED3017 | WormBase | 2026-10-10 10:51:24 | 1 | ||||
|
ED3052 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006640 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype" | WB-STRAIN:WBStrain00006640 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:37008729 PMID:37572357 PMID:38564369 |
WB-STRAIN:ED3052, CGC_ED3052 | WormBase | 2026-10-10 10:51:24 | 1 | ||||
|
ED3046 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006635 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin" | WB-STRAIN:WBStrain00006635 | WormBase (WB) | WB | available | PMID:32857789 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3046, CGC_ED3046 | WormBase | 2026-10-10 10:51:24 | 1 | ||||
|
EG276 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006661 | Caenorhabditis elegans | exp-1(ox276) II. | Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52. | WBGene00001373(exp-1) | WBGene00001373(exp-1) | WB-STRAIN:WBStrain00006661 | WormBase (WB) | WB | available | WB-STRAIN:EG276, CGC_EG276 | WormBase | 2026-10-10 10:51:25 | 2 | |||
|
EG199 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006660 | Caenorhabditis elegans | nas-37(ox199) X. | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. | WBGene00003553(nas-37) | WBGene00003553(nas-37) | WB-STRAIN:WBStrain00006660 | WormBase (WB) | WB | available | PMID:38177158 | WB-STRAIN:EG199, CGC_EG199 | WormBase | 2026-10-10 10:51:25 | 1 | ||
|
EG144 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006659 | Caenorhabditis elegans | inx-16(ox144) I. | Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8. | WBGene00002138(inx-16) | WBGene00002138(inx-16) | WB-STRAIN:WBStrain00006659 | WormBase (WB) | WB | available | WB-STRAIN:EG144, CGC_EG144 | WormBase | 2026-10-10 10:51:25 | 2 | |||
|
EG1285 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006667 | Caenorhabditis elegans | lin-15B&lin-15A(n765) oxIs12 X. | Mutagen:Integrated by X-rays|"oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons."|"Supplementary_genotype GABA-GFP oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12[punc-47::gfp] X"|"WBStrain provided so WBPaper00061788 paper added based on AFP_Strain data." | WBGene00006783(unc-47)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00006783(unc-47), WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00006667 | WormBase (WB) | WB | available | PMID:31662251 PMID:34387338 PMID:37083456 PMID:37756590 PMID:37910615 PMID:39097626 PMID:39615303 |
WB-STRAIN:EG1285, CGC_EG1285 | WormBase | 2026-10-10 10:51:25 | 5 | ||
|
EG6070 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006721 | Caenorhabditis elegans | oxSi221 II; unc-119(ed3) III. | oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.|"WBStrain provided so WBPaper00062054 paper added based on AFP_Strain data." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00006721 | WormBase (WB) | WB | available | PMID:34665130 | WB-STRAIN:EG6070, CGC_EG6070 | WormBase | 2026-10-10 10:51:26 | 2 | ||
|
EG6699 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006736 | Caenorhabditis elegans | ttTi5605 II; unc-119(ed3) III; oxEx1578. | Growth temperature 15 degC|"oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]"|"Reference WBPaper00054440 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype ttTi5605 II unc-119 (ed3) III oxEx1578 (eft-3p::GFP + Cbr-unc-119(+))"|"WBStrain mapped, WBPaper00059536 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059884 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061624 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061786 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061940 paper added based on AFP_Strain data." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00006736 | WormBase (WB) | WB | available | PMID:18953339 PMID:32550365 PMID:31995031 PMID:32275886 PMID:32587090 PMID:32687264 PMID:33543000 PMID:33976151 PMID:34003969 PMID:34397094 PMID:34542850 PMID:37857834 PMID:38329452 PMID:38456967 PMID:38498505 PMID:38547054 PMID:38797871 PMID:38744971 PMID:38924277 PMID:39105756 |
WB-STRAIN:EG6699, CGC_EG6699 | WormBase | 2026-10-10 10:51:26 | 8 | ||
|
EG5025 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006709 | Caenorhabditis elegans | oxIs351 X. | oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type. | WB-STRAIN:WBStrain00006709 | WormBase (WB) | WB | available | WB-STRAIN:EG5025, CGC_EG5025 | WormBase | 2026-10-10 10:51:25 | 1 | |||||
|
EG4946 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006704 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. | WB-STRAIN:WBStrain00006704 | WormBase (WB) | WB | available | PMID:33820969 PMID:38564369 |
WB-STRAIN:EG4946, CGC_EG4946 | WormBase | 2026-10-10 10:51:25 | 1 | ||||
|
HZ1687 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008600 | Caenorhabditis elegans | atg-9(bp564) him-5(e1490) V. | Him; ~30% male.|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data." | WBGene00001864(him-5)|WBGene00020706(atg-9) | WBGene00001864(him-5), WBGene00020706(atg-9) | WB-STRAIN:WBStrain00008600 | WormBase (WB) | WB | available | PMID:32302543 PMID:39570954 |
WB-STRAIN:HZ1687, CGC_HZ1687 | WormBase | 2026-10-10 10:51:56 | 1 | ||
|
HZ1688 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008601 | Caenorhabditis elegans | atg-13(bp414) III. | WBStrain mapped, WBPaper00059578 added based on AFP_Strain data. | WBGene00017045(atg-13) | WBGene00017045(atg-13) | WB-STRAIN:WBStrain00008601 | WormBase (WB) | WB | available | PMID:32302543 PMID:35065714 PMID:39746999 |
WB-STRAIN:HZ1688, CGC_HZ1688 | WormBase | 2026-10-10 10:51:56 | 4 | ||
|
HY494 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008569 | Caenorhabditis elegans | bre-2(ye31) III. | Made_by: Elyassnia/Aroian|"Resistant to Cry5B Bt toxin. Reduced brood size." | WBGene00000267(bre-2) | WBGene00000267(bre-2) | WB-STRAIN:WBStrain00008569 | WormBase (WB) | WB | available | WB-STRAIN:HY494, CGC_HY494 | WormBase | 2026-10-10 10:51:56 | 1 | |||
|
HY496 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008570 | Caenorhabditis elegans | bre-1(ye4) IV. | Made_by: Elyassnia/Aroian|"Resistant to Cry5B Bt toxin. Reduced brood size." | WBGene00000266(bre-1) | WBGene00000266(bre-1) | WB-STRAIN:WBStrain00008570 | WormBase (WB) | WB | available | PMID:38719808 | WB-STRAIN:HY496, CGC_HY496 | WormBase | 2026-10-10 10:51:56 | 2 | ||
|
HT1890 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008556 | Caenorhabditis elegans | daf-16(mgDf50) I; daf-2(e1370) III. | Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data." | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00008556 | WormBase (WB) | WB | available | PMID:37577954 | WB-STRAIN:HT1890, CGC_HT1890 | WormBase | 2026-10-10 10:51:56 | 2 | ||
|
HT2099 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00008558 | Caenorhabditis elegans | unc-119(ed3) III; wwEx85. | Made_by: Walhout/Tissenbaum|"wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00008558 | WormBase (WB) | WB | available | WB-STRAIN:HT2099, CGC_HT2099 | WormBase | 2026-10-10 10:51:56 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
