Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 85 showing 1681 ~ 1700 out of 40,462 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00006678

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006678

Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.

Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy   

    • RRID:WB-STRAIN:WBStrain00006618

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006618

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3011, CGC_ED3011
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006618 Copy   

    • RRID:WB-STRAIN:WBStrain00006698

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006698

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33593818, PMID:33820969, PMID:38564369, PMID:39303031, PMID:39853894
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4725, CGC_EG4725
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006698 Copy   

    • RRID:WB-STRAIN:WBStrain00006622

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006622

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3017, CGC_ED3017
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006622 Copy   

    • RRID:WB-STRAIN:WBStrain00006640

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006640

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:37008729, PMID:37572357, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3052, CGC_ED3052
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype"

Proper citation: RRID:WB-STRAIN:WBStrain00006640 Copy   

    • RRID:WB-STRAIN:WBStrain00006635

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006635

Source Database: WormBase (WB)
Availability: available
Source References: PMID:32857789, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3046, CGC_ED3046
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006635 Copy   

    • RRID:WB-STRAIN:WBStrain00006661

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006661

Source Database: WormBase (WB)
Affected Genes: WBGene00001373(exp-1)
Genomic Alteration: WBGene00001373(exp-1)
Availability: available
Synonyms: exp-1(ox276) II.
Alternate IDs: WB-STRAIN:EG276, CGC_EG276
Notes: Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.

Proper citation: RRID:WB-STRAIN:WBStrain00006661 Copy   

    • RRID:WB-STRAIN:WBStrain00006660

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006660

Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: PMID:38177158
Synonyms: nas-37(ox199) X.
Alternate IDs: WB-STRAIN:EG199, CGC_EG199
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.

Proper citation: RRID:WB-STRAIN:WBStrain00006660 Copy   

    • RRID:WB-STRAIN:WBStrain00006659

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006659

Source Database: WormBase (WB)
Affected Genes: WBGene00002138(inx-16)
Genomic Alteration: WBGene00002138(inx-16)
Availability: available
Synonyms: inx-16(ox144) I.
Alternate IDs: WB-STRAIN:EG144, CGC_EG144
Notes: Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.

Proper citation: RRID:WB-STRAIN:WBStrain00006659 Copy   

    • RRID:WB-STRAIN:WBStrain00006667

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006667

Source Database: WormBase (WB)
Affected Genes: WBGene00006783(unc-47)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00006783(unc-47), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:31662251, PMID:34387338, PMID:37083456, PMID:37756590, PMID:37910615, PMID:39097626, PMID:39615303
Synonyms: lin-15B&lin-15A(n765) oxIs12 X.
Alternate IDs: WB-STRAIN:EG1285, CGC_EG1285
Notes: Mutagen:Integrated by X-rays|"oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons."|"Supplementary_genotype GABA-GFP oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12 [unc-47p::GFP + lin-15(+)]"|"Supplementary_genotype oxIs12[punc-47::gfp] X"|"WBStrain provided so WBPaper00061788 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006667 Copy   

    • RRID:WB-STRAIN:WBStrain00006721

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006721

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:34665130
Synonyms: oxSi221 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:EG6070, CGC_EG6070
Notes: oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.|"WBStrain provided so WBPaper00062054 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006721 Copy   

    • RRID:WB-STRAIN:WBStrain00006736

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006736

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:18953339, PMID:32550365, PMID:31995031, PMID:32275886, PMID:32587090, PMID:32687264, PMID:33543000, PMID:33976151, PMID:34003969, PMID:34397094, PMID:34542850, PMID:37857834, PMID:38329452, PMID:38456967, PMID:38498505, PMID:38547054, PMID:38797871, PMID:38744971, PMID:38924277, PMID:39105756
Synonyms: ttTi5605 II; unc-119(ed3) III; oxEx1578.
Alternate IDs: WB-STRAIN:EG6699, CGC_EG6699
Notes: Growth temperature 15 degC|"oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]"|"Reference WBPaper00054440 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype ttTi5605 II unc-119 (ed3) III oxEx1578 (eft-3p::GFP + Cbr-unc-119(+))"|"WBStrain mapped, WBPaper00059536 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059884 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061624 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061786 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061940 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006736 Copy   

    • RRID:WB-STRAIN:WBStrain00006709

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006709

Source Database: WormBase (WB)
Availability: available
Synonyms: oxIs351 X.
Alternate IDs: WB-STRAIN:EG5025, CGC_EG5025
Notes: oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.

Proper citation: RRID:WB-STRAIN:WBStrain00006709 Copy   

    • RRID:WB-STRAIN:WBStrain00006704

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006704

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4946, CGC_EG4946
Notes: C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

Proper citation: RRID:WB-STRAIN:WBStrain00006704 Copy   

    • RRID:WB-STRAIN:WBStrain00008600

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008600

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00020706(atg-9)
Genomic Alteration: WBGene00001864(him-5), WBGene00020706(atg-9)
Availability: available
Source References: PMID:32302543, PMID:39570954
Synonyms: atg-9(bp564) him-5(e1490) V.
Alternate IDs: WB-STRAIN:HZ1687, CGC_HZ1687
Notes: Him; ~30% male.|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00008600 Copy   

    • RRID:WB-STRAIN:WBStrain00008601

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008601

Source Database: WormBase (WB)
Affected Genes: WBGene00017045(atg-13)
Genomic Alteration: WBGene00017045(atg-13)
Availability: available
Source References: PMID:32302543, PMID:35065714, PMID:39746999
Synonyms: atg-13(bp414) III.
Alternate IDs: WB-STRAIN:HZ1688, CGC_HZ1688
Notes: WBStrain mapped, WBPaper00059578 added based on AFP_Strain data.

Proper citation: RRID:WB-STRAIN:WBStrain00008601 Copy   

    • RRID:WB-STRAIN:WBStrain00008569

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008569

Source Database: WormBase (WB)
Affected Genes: WBGene00000267(bre-2)
Genomic Alteration: WBGene00000267(bre-2)
Availability: available
Synonyms: bre-2(ye31) III.
Alternate IDs: WB-STRAIN:HY494, CGC_HY494
Notes: Made_by: Elyassnia/Aroian|"Resistant to Cry5B Bt toxin. Reduced brood size."

Proper citation: RRID:WB-STRAIN:WBStrain00008569 Copy   

    • RRID:WB-STRAIN:WBStrain00008570

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008570

Source Database: WormBase (WB)
Affected Genes: WBGene00000266(bre-1)
Genomic Alteration: WBGene00000266(bre-1)
Availability: available
Source References: PMID:38719808
Synonyms: bre-1(ye4) IV.
Alternate IDs: WB-STRAIN:HY496, CGC_HY496
Notes: Made_by: Elyassnia/Aroian|"Resistant to Cry5B Bt toxin. Reduced brood size."

Proper citation: RRID:WB-STRAIN:WBStrain00008570 Copy   

    • RRID:WB-STRAIN:WBStrain00008556

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008556

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: available
Source References: PMID:37577954
Synonyms: daf-16(mgDf50) I; daf-2(e1370) III.
Alternate IDs: WB-STRAIN:HT1890, CGC_HT1890
Notes: Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00008556 Copy   

    • RRID:WB-STRAIN:WBStrain00008558

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008558

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; wwEx85.
Alternate IDs: WB-STRAIN:HT2099, CGC_HT2099
Notes: Made_by: Walhout/Tissenbaum|"wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28."

Proper citation: RRID:WB-STRAIN:WBStrain00008558 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Test 10092026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch