Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 85 showing 1681 ~ 1700 out of 62,713 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00030907

http://www.wormbase.org/db/get?name=WBStrain00030907

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: syIs66 II; unc-119(ed4) III.
Alternate IDs: WB-STRAIN:PS3665, CGC_PS3665
Notes: syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00030907 Copy   


  • RRID:WB-STRAIN:WBStrain00030905

http://www.wormbase.org/db/get?name=WBStrain00030905

Source Database: WormBase (WB)
Affected Genes: WBGene00000584(cog-1)
Genomic Alteration: WBGene00000584(cog-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PS3663
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00030905 Copy   


  • RRID:WB-STRAIN:WBStrain00030904

http://www.wormbase.org/db/get?name=WBStrain00030904

Source Database: WormBase (WB)
Affected Genes: WBGene00000584(cog-1)
Genomic Alteration: WBGene00000584(cog-1)
Availability: available
Source References: PMID:26024448
Synonyms: syIs63.
Alternate IDs: WB-STRAIN:PS3662, CGC_PS3662
Notes: syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"syIs63[cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."

Proper citation: RRID:WB-STRAIN:WBStrain00030904 Copy   


  • RRID:WB-STRAIN:WBStrain00030903

http://www.wormbase.org/db/get?name=WBStrain00030903

Source Database: WormBase (WB)
Affected Genes: WBGene00002146(ipp-5)
Genomic Alteration: WBGene00002146(ipp-5)
Availability: available
Source References: EMPTY
Synonyms: ipp-5(sy605) X.
Alternate IDs: WB-STRAIN:PS3653, CGC_PS3653
Notes: Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00030903 Copy   


  • RRID:WB-STRAIN:WBStrain00031002

http://www.wormbase.org/db/get?name=WBStrain00031002

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs337 syIs398 III.
Alternate IDs: WB-STRAIN:PS7169, CGC_PS7169
Notes: Made_by: Han Wang and Jonathan Liu|"syIs337 [15xUAS::pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031002 Copy   


  • RRID:WB-STRAIN:WBStrain00031089

http://www.wormbase.org/db/get?name=WBStrain00031089

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah91)II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM317
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031089 Copy   


  • RRID:WB-STRAIN:WBStrain00031086

http://www.wormbase.org/db/get?name=WBStrain00031086

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-10 (kah83)II kyIR1(V, CB4856>N2) qgIR1(X, CB4856>N2).
Alternate IDs: WB-STRAIN:PTM288
Notes: Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997

Proper citation: RRID:WB-STRAIN:WBStrain00031086 Copy   


  • RRID:WB-STRAIN:WBStrain00031085

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031085

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38771761
Synonyms: dpy-10 (kah82)II.
Alternate IDs: WB-STRAIN:PTM229
Notes: Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997

Proper citation: RRID:WB-STRAIN:WBStrain00031085 Copy   


  • RRID:WB-STRAIN:WBStrain00031084

http://www.wormbase.org/db/get?name=WBStrain00031084

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah66,kah73)II
Alternate IDs: WB-STRAIN:PTM211
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031084 Copy   


  • RRID:WB-STRAIN:WBStrain00031009

http://www.wormbase.org/db/get?name=WBStrain00031009

Source Database: WormBase (WB)
Availability: available
Source References: PMID:38096407
Synonyms: syIs371 III.
Alternate IDs: WB-STRAIN:PS7199, CGC_PS7199
Notes: Made_by: Han Wang and Jonathan Liu|"syIs371"|"syIs371[15xUAS::pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031009 Copy   


  • RRID:WB-STRAIN:WBStrain00031007

http://www.wormbase.org/db/get?name=WBStrain00031007

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs409 X.
Alternate IDs: WB-STRAIN:PS7190, CGC_PS7190
Notes: Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031007 Copy   


  • RRID:WB-STRAIN:WBStrain00031005

http://www.wormbase.org/db/get?name=WBStrain00031005

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs406 IV.
Alternate IDs: WB-STRAIN:PS7185, CGC_PS7185
Notes: Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031005 Copy   


  • RRID:WB-STRAIN:WBStrain00031093

http://www.wormbase.org/db/get?name=WBStrain00031093

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah106) II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM332
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031093 Copy   


  • RRID:WB-STRAIN:WBStrain00031092

http://www.wormbase.org/db/get?name=WBStrain00031092

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah99)II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM325
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031092 Copy   


  • RRID:WB-STRAIN:WBStrain00031091

http://www.wormbase.org/db/get?name=WBStrain00031091

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nurf-1(kah96)II/ oxTi924 II
Alternate IDs: WB-STRAIN:PTM322
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031091 Copy   


  • RRID:WB-STRAIN:WBStrain00031014

http://www.wormbase.org/db/get?name=WBStrain00031014

Source Database: WormBase (WB)
Affected Genes: WBGene00019361(clik-3)
Genomic Alteration: WBGene00019361(clik-3)
Availability: available
Source References: PMID:30224336
Synonyms: K03E5.2(sy1082) I.
Alternate IDs: WB-STRAIN:PS7731, CGC_PS7731
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)."

Proper citation: RRID:WB-STRAIN:WBStrain00031014 Copy   


  • RRID:WB-STRAIN:WBStrain00031018

http://www.wormbase.org/db/get?name=WBStrain00031018

Source Database: WormBase (WB)
Affected Genes: WBGene00020808(clik-1)
Genomic Alteration: WBGene00020808(clik-1)
Availability: available
Source References: PMID:30224336
Synonyms: clik-1(sy1084) V.
Alternate IDs: WB-STRAIN:PS7778, CGC_PS7778
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)."

Proper citation: RRID:WB-STRAIN:WBStrain00031018 Copy   


  • RRID:WB-STRAIN:WBStrain00031017

http://www.wormbase.org/db/get?name=WBStrain00031017

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: T05C3.2(sy1081) V
Alternate IDs: WB-STRAIN:PS7735
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031017 Copy   


  • RRID:WB-STRAIN:WBStrain00031016

http://www.wormbase.org/db/get?name=WBStrain00031016

Source Database: WormBase (WB)
Affected Genes: WBGene00020254(T05C3.2)
Genomic Alteration: WBGene00020254(T05C3.2)
Availability: available
Source References: PMID:30224336
Synonyms: T05C3.2(sy1080) V.
Alternate IDs: WB-STRAIN:PS7734, CGC_PS7734
Notes: Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00031016 Copy   


  • RRID:WB-STRAIN:WBStrain00031015

http://www.wormbase.org/db/get?name=WBStrain00031015

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30224336
Synonyms: K03E5.2 (sy1083) I
Alternate IDs: WB-STRAIN:PS7732
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031015 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X