Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027591
Source Database: WormBase (WB)
Availability: available
Synonyms: nIs289 X.
Alternate IDs: WB-STRAIN:MT18145, CGC_MT18145
Notes: Mutagen:Gamma radiation|"nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50."
Proper citation: RRID:WB-STRAIN:WBStrain00027591 Copy
http://www.wormbase.org/db/get?name=WBStrain00027592
Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Synonyms: nDf53 III; mir-58.1(n4640) IV.
Alternate IDs: WB-STRAIN:MT18409, CGC_MT18409
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027592 Copy
http://www.wormbase.org/db/get?name=WBStrain00027506
Source Database: WormBase (WB)
Affected Genes: WBGene00003311(mir-83)
Genomic Alteration: WBGene00003311(mir-83)
Availability: available
Synonyms: mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:MT15022, CGC_MT15022
Notes: Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027506 Copy
http://www.wormbase.org/db/get?name=WBStrain00027509
Source Database: WormBase (WB)
Affected Genes: WBGene00003362(mir-269)
Genomic Alteration: WBGene00003362(mir-269)
Availability: available
Synonyms: mir-269(n4641) IV.
Alternate IDs: WB-STRAIN:MT15025, CGC_MT15025
Notes: Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027509 Copy
http://www.wormbase.org/db/get?name=WBStrain00027503
Source Database: WormBase (WB)
Availability: available
Source References: PMID:38594249
Synonyms: nDf60 V.
Alternate IDs: WB-STRAIN:MT15019, CGC_MT15019
Notes: Made_by: Horvitz Lab|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027503 Copy
http://www.wormbase.org/db/get?name=WBStrain00027504
Source Database: WormBase (WB)
Affected Genes: WBGene00003340(mir-246)
Genomic Alteration: WBGene00003340(mir-246)
Availability: available
Source References: PMID:31307392
Synonyms: mir-246(n4636) IV.
Alternate IDs: WB-STRAIN:MT15020, CGC_MT15020
Notes: Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027504 Copy
http://www.wormbase.org/db/get?name=WBStrain00027505
Source Database: WormBase (WB)
Affected Genes: WBGene00003306(mir-78)
Genomic Alteration: WBGene00003306(mir-78)
Availability: available
Synonyms: mir-78(n4637) IV.
Alternate IDs: WB-STRAIN:MT15021, CGC_MT15021
Notes: Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027505 Copy
http://www.wormbase.org/db/get?name=WBStrain00027586
Source Database: WormBase (WB)
Affected Genes: WBGene00002993(lin-4)|WBGene00003330(mir-237)
Genomic Alteration: WBGene00002993(lin-4), WBGene00003330(mir-237)
Availability: available
Synonyms: lin-4(e912) II; mir-237(n4296) X.
Alternate IDs: WB-STRAIN:MT18023, CGC_MT18023
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027586 Copy
http://www.wormbase.org/db/get?name=WBStrain00027588
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)|WBGene00045343(mir-786)
Genomic Alteration: WBGene00003334(mir-240), WBGene00045343(mir-786)
Availability: available
Synonyms: mir-240&mir-786(n4541) X.
Alternate IDs: WB-STRAIN:MT18043, CGC_MT18043
Notes: Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027588 Copy
http://www.wormbase.org/db/get?name=WBStrain00027656
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:30078564, PMID:33593818, PMID:33820969, PMID:38547054, PMID:38564369
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:MY10, CGC_MY10
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate"
Proper citation: RRID:WB-STRAIN:WBStrain00027656 Copy
http://www.wormbase.org/db/get?name=WBStrain00027650
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY4, CGC_MY4
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027650 Copy
http://www.wormbase.org/db/get?name=WBStrain00027649
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY3, CGC_MY3
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027649 Copy
http://www.wormbase.org/db/get?name=WBStrain00027645
Source Database: WormBase (WB)
Affected Genes: WBGene00016935(ifta-1)
Genomic Alteration: WBGene00016935(ifta-1)
Availability: available
Source References: PMID:38302462
Synonyms: ifta-1(nx61) X.
Alternate IDs: WB-STRAIN:MX124, CGC_MX124
Notes: Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
Proper citation: RRID:WB-STRAIN:WBStrain00027645 Copy
http://www.wormbase.org/db/get?name=WBStrain00027647
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:31422888, PMID:33820969, PMID:34622777, PMID:38564369, PMID:38865452
Synonyms: wild
Alternate IDs: WB-STRAIN:MY1, CGC_MY1
Notes: Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1.
Proper citation: RRID:WB-STRAIN:WBStrain00027647 Copy
http://www.wormbase.org/db/get?name=WBStrain00027641
Source Database: WormBase (WB)
Affected Genes: WBGene00000244(bbs-8)
Genomic Alteration: WBGene00000244(bbs-8)
Availability: available
Source References: PMID:32101165, PMID:32916106, PMID:34533135, PMID:38302462, PMID:38421867
Synonyms: bbs-8(nx77) V
Alternate IDs: WB-STRAIN:MX52, CGC_MX52
Notes: Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027641 Copy
http://www.wormbase.org/db/get?name=WBStrain00027668
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY22, CGC_MY22
Notes: Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU5.
Proper citation: RRID:WB-STRAIN:WBStrain00027668 Copy
http://www.wormbase.org/db/get?name=WBStrain00027663
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY17, CGC_MY17
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU5.
Proper citation: RRID:WB-STRAIN:WBStrain00027663 Copy
http://www.wormbase.org/db/get?name=WBStrain00027664
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369, PMID:38865452, PMID:39303031
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY18, CGC_MY18
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU4.
Proper citation: RRID:WB-STRAIN:WBStrain00027664 Copy
http://www.wormbase.org/db/get?name=WBStrain00027665
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY19, CGC_MY19
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027665 Copy
http://www.wormbase.org/db/get?name=WBStrain00027666
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY20, CGC_MY20
Notes: Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027666 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
