Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 80 showing 1581 ~ 1600 out of 147,321 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00027430

http://www.wormbase.org/db/get?name=WBStrain00027430

Source Database: WormBase (WB)
Availability: available
Synonyms: nDf49 II.
Alternate IDs: WB-STRAIN:MT13372, CGC_MT13372
Notes: Made_by: Horvitz Lab|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."

Proper citation: RRID:WB-STRAIN:WBStrain00027430 Copy   


  • RRID:WB-STRAIN:WBStrain00027429

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027429

Source Database: WormBase (WB)
Affected Genes: WBGene00019883(met-2)
Genomic Alteration: WBGene00019883(met-2)
Availability: available
Source References: PMID:31815663, PMID:32451438, PMID:34648748
Synonyms: met-2(n4256) III
Alternate IDs: WB-STRAIN:MT13293, CGC_MT13293
Notes: Deletion of R05D3.11.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search."

Proper citation: RRID:WB-STRAIN:WBStrain00027429 Copy   


  • RRID:WB-STRAIN:WBStrain00027425

http://www.wormbase.org/db/get?name=WBStrain00027425

Source Database: WormBase (WB)
Affected Genes: WBGene00007029(mys-1)
Genomic Alteration: WBGene00007029(mys-1)
Availability: available
Synonyms: mys-1(n4075) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MT13172, CGC_MT13172
Notes: Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027425 Copy   


  • RRID:WB-STRAIN:WBStrain00027427

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027427

Source Database: WormBase (WB)
Affected Genes: WBGene00022149(lin-65)
Genomic Alteration: WBGene00022149(lin-65)
Availability: available
Synonyms: lin-65(n3441) I.
Alternate IDs: WB-STRAIN:MT13232, CGC_MT13232
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00027427 Copy   


  • RRID:WB-STRAIN:WBStrain00027428

http://www.wormbase.org/db/get?name=WBStrain00027428

Source Database: WormBase (WB)
Affected Genes: WBGene00003319(mir-124)
Genomic Alteration: WBGene00003319(mir-124)
Availability: available
Synonyms: mir-124(n4255) IV.
Alternate IDs: WB-STRAIN:MT13292, CGC_MT13292
Notes: Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027428 Copy   


  • RRID:WB-STRAIN:WBStrain00027422

http://www.wormbase.org/db/get?name=WBStrain00027422

Source Database: WormBase (WB)
Affected Genes: WBGene00004829(sli-1)
Genomic Alteration: WBGene00004829(sli-1)
Availability: available
Synonyms: sli-1(n3538) X.
Alternate IDs: WB-STRAIN:MT13032, CGC_MT13032
Notes: SynMuv.

Proper citation: RRID:WB-STRAIN:WBStrain00027422 Copy   


  • RRID:WB-STRAIN:WBStrain00027461

http://www.wormbase.org/db/get?name=WBStrain00027461

Source Database: WormBase (WB)
Affected Genes: WBGene00003279(mir-51)
Genomic Alteration: WBGene00003279(mir-51)
Availability: available
Synonyms: mir-51(n4473) IV.
Alternate IDs: WB-STRAIN:MT14450, CGC_MT14450
Notes: Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027461 Copy   


  • RRID:WB-STRAIN:WBStrain00027462

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027462

Source Database: WormBase (WB)
Affected Genes: WBGene00003304(mir-76)
Genomic Alteration: WBGene00003304(mir-76)
Availability: available
Synonyms: mir-76(n4474) III.
Alternate IDs: WB-STRAIN:MT14451, CGC_MT14451
Notes: Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027462 Copy   


  • RRID:WB-STRAIN:WBStrain00027464

http://www.wormbase.org/db/get?name=WBStrain00027464

Source Database: WormBase (WB)
Affected Genes: WBGene00018023(set-11)
Genomic Alteration: WBGene00018023(set-11)
Availability: available
Synonyms: set-11(n4488) II.
Alternate IDs: WB-STRAIN:MT14480, CGC_MT14480
Notes: Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9.

Proper citation: RRID:WB-STRAIN:WBStrain00027464 Copy   


  • RRID:WB-STRAIN:WBStrain00027460

http://www.wormbase.org/db/get?name=WBStrain00027460

Source Database: WormBase (WB)
Affected Genes: WBGene00003325(mir-232)
Genomic Alteration: WBGene00003325(mir-232)
Availability: available
Synonyms: mir-232(nDf56) IV.
Alternate IDs: WB-STRAIN:MT14449, CGC_MT14449
Notes: Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"

Proper citation: RRID:WB-STRAIN:WBStrain00027460 Copy   


  • RRID:WB-STRAIN:WBStrain00027458

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027458

Source Database: WormBase (WB)
Affected Genes: WBGene00003321(mir-228)
Genomic Alteration: WBGene00003321(mir-228)
Availability: available
Synonyms: mir-228(n4382) IV.
Alternate IDs: WB-STRAIN:MT14446, CGC_MT14446
Notes: Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027458 Copy   


  • RRID:WB-STRAIN:WBStrain00027459

http://www.wormbase.org/db/get?name=WBStrain00027459

Source Database: WormBase (WB)
Affected Genes: WBGene00003303(mir-75)|WBGene00003307(mir-79)
Genomic Alteration: WBGene00003303(mir-75), WBGene00003307(mir-79)
Availability: available
Synonyms: mir-79(n4126) I; mir-75(n4472) X.
Alternate IDs: WB-STRAIN:MT14448, CGC_MT14448
Notes: Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.

Proper citation: RRID:WB-STRAIN:WBStrain00027459 Copy   


  • RRID:WB-STRAIN:WBStrain00027454

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027454

Source Database: WormBase (WB)
Affected Genes: WBGene00001502(ftt-2)
Genomic Alteration: WBGene00001502(ftt-2)
Availability: available
Synonyms: ftt-2(n4426) X.
Alternate IDs: WB-STRAIN:MT14355, CGC_MT14355
Notes: Mutagen:UV/TMP|"Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null."

Proper citation: RRID:WB-STRAIN:WBStrain00027454 Copy   


  • RRID:WB-STRAIN:WBStrain00027455

http://www.wormbase.org/db/get?name=WBStrain00027455

Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)|WBGene00019883(met-2)
Genomic Alteration: WBGene00001995(hpl-1), WBGene00019883(met-2)
Availability: available
Synonyms: met-2(n4256) III; hpl-1(n4317) X.
Alternate IDs: WB-STRAIN:MT14378, CGC_MT14378
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00027455 Copy   


  • RRID:WB-STRAIN:WBStrain00027457

http://www.wormbase.org/db/get?name=WBStrain00027457

Source Database: WormBase (WB)
Affected Genes: WBGene00019584(set-12)
Genomic Alteration: WBGene00019584(set-12)
Availability: available
Synonyms: set-12(n4442) X.
Alternate IDs: WB-STRAIN:MT14401, CGC_MT14401
Notes: Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.

Proper citation: RRID:WB-STRAIN:WBStrain00027457 Copy   


  • RRID:WB-STRAIN:WBStrain00027450

http://www.wormbase.org/db/get?name=WBStrain00027450

Source Database: WormBase (WB)
Availability: available
Synonyms: nDf50 II.
Alternate IDs: WB-STRAIN:MT14119, CGC_MT14119
Notes: Made_by: Horvitz Lab|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."

Proper citation: RRID:WB-STRAIN:WBStrain00027450 Copy   


  • RRID:WB-STRAIN:WBStrain00027451

http://www.wormbase.org/db/get?name=WBStrain00027451

Source Database: WormBase (WB)
Availability: available
Synonyms: nDf53 III; nDf54 X.
Alternate IDs: WB-STRAIN:MT14128, CGC_MT14128
Notes: Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.

Proper citation: RRID:WB-STRAIN:WBStrain00027451 Copy   


  • RRID:WB-STRAIN:WBStrain00027453

http://www.wormbase.org/db/get?name=WBStrain00027453

Source Database: WormBase (WB)
Affected Genes: WBGene00003366(mir-273)
Genomic Alteration: WBGene00003366(mir-273)
Availability: available
Synonyms: mir-273(n4438) II.
Alternate IDs: WB-STRAIN:MT14347, CGC_MT14347
Notes: Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027453 Copy   


  • RRID:WB-STRAIN:WBStrain00027447

http://www.wormbase.org/db/get?name=WBStrain00027447

Source Database: WormBase (WB)
Affected Genes: WBGene00003307(mir-79)
Genomic Alteration: WBGene00003307(mir-79)
Availability: available
Synonyms: mir-79(n4126) I.
Alternate IDs: WB-STRAIN:MT14091, CGC_MT14091
Notes: Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027447 Copy   


  • RRID:WB-STRAIN:WBStrain00027449

http://www.wormbase.org/db/get?name=WBStrain00027449

Source Database: WormBase (WB)
Affected Genes: WBGene00003312(mir-84)|WBGene00003335(mir-241)
Genomic Alteration: WBGene00003312(mir-84), WBGene00003335(mir-241)
Availability: available
Synonyms: mir-241(n4315) V; mir-84(n4037) X.
Alternate IDs: WB-STRAIN:MT14118, CGC_MT14118
Notes: Superficially WT.

Proper citation: RRID:WB-STRAIN:WBStrain00027449 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X