Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00003983

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct181) IV.
Alternate IDs: WB-STRAIN:BW1176, CGC_BW1176
Notes: Made_by Mark Yandell|"Made_by: Mark Yandell"|"Mutagen: Trimethylpsoalen"

Proper citation: RRID:WB-STRAIN:WBStrain00003983 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003980

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct174) IV.
Alternate IDs: WB-STRAIN:BW1166, CGC_BW1166
Notes: Mutagen: Trimethylpsoalen|"Twitcher."

Proper citation: RRID:WB-STRAIN:WBStrain00003980 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003981

Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct176) IV.
Alternate IDs: WB-STRAIN:BW1168, CGC_BW1168
Notes: Mutagen: Trimethylpsoalen|"Twitcher."

Proper citation: RRID:WB-STRAIN:WBStrain00003981 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003914

Source Database: WormBase (WB)
Availability: available
Synonyms: byIs193.
Alternate IDs: WB-STRAIN:BR5944, CGC_BR5944
Notes: byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.|"Made_by: C. Fatouros"|"Mutagen:Gamma radiation"

Proper citation: RRID:WB-STRAIN:WBStrain00003914 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003995

Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)|WBGene00002645(let-427)|WBGene00006782(unc-46)
Genomic Alteration: WBGene00001077(dpy-18), WBGene00002645(let-427), WBGene00006782(unc-46)
Availability: available
Source References: PMID:1752418
Synonyms: dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V.
Alternate IDs: WB-STRAIN:BW1747, CGC_BW1747
Notes: Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.|"Mutagen:from BC3006"

Proper citation: RRID:WB-STRAIN:WBStrain00003995 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003996

Source Database: WormBase (WB)
Affected Genes: WBGene00001678(gpa-16)|WBGene00001864(him-5)
Genomic Alteration: WBGene00001678(gpa-16), WBGene00001864(him-5)
Availability: available
Synonyms: gpa-16(it143) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:BW1809, CGC_BW1809
Notes: Made_by: D. Bergmann|"Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs."

Proper citation: RRID:WB-STRAIN:WBStrain00003996 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003994

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006796(unc-62)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006796(unc-62)
Availability: available
Synonyms: +/eT1 III; unc-62(t2012) dpy-11(e224)/eT1 V.
Alternate IDs: WB-STRAIN:BW1739, CGC_BW1739
Notes: Heterozygotes are wild-type, and segregate WT heterozygotes, Dpy Mel (unc-62 dpy-11 homozygotes), and dead eggs (eT1 homozygotes). unc-62 dpy-11 homozygotes give only dead embryos (96%) or dead larva (4%).|"Made_by: R. Feitchinger"

Proper citation: RRID:WB-STRAIN:WBStrain00003994 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003991

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003912(pal-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003912(pal-1)
Availability: available
Synonyms: pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:BW1566, CGC_BW1566
Notes: Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

Proper citation: RRID:WB-STRAIN:WBStrain00003991 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003938

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001595(gld-1)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001595(gld-1), WBGene00006752(unc-13)
Availability: available
Source References: PMID:7713419, PMID:30599151
Synonyms: unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:BS3156, CGC_BS3156
Notes: Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.|"Mutagen: Psoralen"

Proper citation: RRID:WB-STRAIN:WBStrain00003938 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003936

Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00006768(unc-32)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001609(glp-1), WBGene00006768(unc-32), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9043073
Synonyms: unc-32(e189) glp-1(oz112)/unc-36(e251) glp-1(q175) III.
Alternate IDs: WB-STRAIN:BS913, CGC_BS913
Notes: Heterozygotes are WT and segregate WT and Uncs (both Unc-32 and Unc-36). Tumorous germline phenotype in both hermaphrodites and males; semidominant and temperature sensitive. Even at permissive temperatures (15-20C) brood size is very small (10-20 viable progeny) because of the overproliferation of germ cells at the expense of oogenesis.|"No longer available from the CGC catalogue 24/04/2020"

Proper citation: RRID:WB-STRAIN:WBStrain00003936 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003934

Source Database: WormBase (WB)
Affected Genes: WBGene00001482(fog-2)
Genomic Alteration: WBGene00001482(fog-2)
Availability: available
Source References: PMID:32338603, PMID:38967024
Synonyms: fog-2(oz40) V.
Alternate IDs: WB-STRAIN:BS553, CGC_BS553
Notes: Male/female strain. Maintain by mating.|"Mutagen: Psoralen"|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00003934 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003931

Source Database: WormBase (WB)
Affected Genes: WBGene00001595(gld-1)
Genomic Alteration: WBGene00001595(gld-1)
Availability: available
Synonyms: gld-1(q266)/nDf24 I.
Alternate IDs: WB-STRAIN:BS14, CGC_BS14
Notes: Heterozygotes are fertile and grow more slowly than gld-1(q266) homozygotes. gld-1(q266) homozygotes are sterile and produce small abnormal oocytes. nDf24 homozygotes are dead.

Proper citation: RRID:WB-STRAIN:WBStrain00003931 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00004001

Source Database: WormBase (WB)
Affected Genes: WBGene00000936(dbl-1)
Genomic Alteration: WBGene00000936(dbl-1)
Availability: available
Synonyms: ctIs40 X.
Alternate IDs: WB-STRAIN:BW1940, CGC_BW1940
Notes: ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98.

Proper citation: RRID:WB-STRAIN:WBStrain00004001 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003948

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018625(prp-17)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018625(prp-17)
Availability: available
Synonyms: prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:BS5431, CGC_BS5431
Notes: Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.|"Made_by: Jessica Kerins"

Proper citation: RRID:WB-STRAIN:WBStrain00003948 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003947

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003783(nos-1)|WBGene00003784(nos-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003783(nos-1), WBGene00003784(nos-2)
Availability: available
Synonyms: nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:BS5351, CGC_BS5351
Notes: Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.

Proper citation: RRID:WB-STRAIN:WBStrain00003947 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003945

Source Database: WormBase (WB)
Affected Genes: WBGene00001303(sec-61.G)|WBGene00004855(sma-1)
Genomic Alteration: WBGene00001303(sec-61.G), WBGene00004855(sma-1)
Availability: available
Source References: PMID:8707849
Synonyms: sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:BS5182, CGC_BS5182
Notes: Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.

Proper citation: RRID:WB-STRAIN:WBStrain00003945 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003942

Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: available
Source References: PMID:37310929, PMID:39532199
Synonyms: pmk-3(ok169).
Alternate IDs: WB-STRAIN:BS3383, CGC_BS3383
Notes: F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.|"Made_by: Barstead/Moulder"

Proper citation: RRID:WB-STRAIN:WBStrain00003942 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003943

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001595(gld-1)|WBGene00001596(gld-2)|WBGene00001609(glp-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001595(gld-1), WBGene00001596(gld-2), WBGene00001609(glp-1), WBGene00006768(unc-32)
Availability: available
Synonyms: gld-2(q497) gld-1(q485)/hT2 [dpy-18(h662)] I; unc-32(e189) glp-1(q175)/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:BS3392, CGC_BS3392
Notes: Heterozygotes are wild-type and segregate WT heterozygotes, Unc (gld-2 gld-1; unc-32 glp-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). Check Unc-32 animals for tumors to confirm presence of glp-1 in the line. glp-1(q175) is nonsense R191 > stop (opal).

Proper citation: RRID:WB-STRAIN:WBStrain00003943 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003940

Source Database: WormBase (WB)
Affected Genes: WBGene00003030(lin-45)
Genomic Alteration: WBGene00003030(lin-45)
Availability: available
Synonyms: lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:BS3347, CGC_BS3347
Notes: Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.

Proper citation: RRID:WB-STRAIN:WBStrain00003940 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00003941

Source Database: WormBase (WB)
Affected Genes: WBGene00007396(rnp-9)
Genomic Alteration: WBGene00007396(rnp-9)
Availability: available
Synonyms: C07A4.1(ok144) X.
Alternate IDs: WB-STRAIN:BS3348, CGC_BS3348
Notes: Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.

Proper citation: RRID:WB-STRAIN:WBStrain00003941 Copy   

•   Source: WormBase