Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00003864
Source Database: WormBase (WB)
Availability: available
Synonyms: bqSi294 II; bqSi542 IV.
Alternate IDs: WB-STRAIN:BN544, CGC_BN544
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi542 [unc-47p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in GABAergic motor neurons and red nuclei elsewhere.
Proper citation: RRID:WB-STRAIN:WBStrain00003864 Copy
http://www.wormbase.org/db/get?name=WBStrain00003861
Source Database: WormBase (WB)
Availability: available
Source References: PMID:36645076, PMID:37831769
Synonyms: bqSi294 II; bqSi506 IV.
Alternate IDs: WB-STRAIN:BN507, CGC_BN507
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in neurons and red nuclei elsewhere.|"Supplementary_genotype bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV"
Proper citation: RRID:WB-STRAIN:WBStrain00003861 Copy
http://www.wormbase.org/db/get?name=WBStrain00003878
Source Database: WormBase (WB)
Affected Genes: WBGene00001159(eff-1)
Genomic Alteration: WBGene00001159(eff-1)
Availability: available
Synonyms: eff-1(hy21) II; hyEx23.
Alternate IDs: WB-STRAIN:BP221, CGC_BP221
Notes: hyEx23 [des-2p::eff-1 + des-2::GFP + rol-6(su1006)]. Cell-specific expression of eff-1 in the PVDs. Partially rescues arborization Eff-1 phenotypes. Pick GFP+ Rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.
Proper citation: RRID:WB-STRAIN:WBStrain00003878 Copy
http://www.wormbase.org/db/get?name=WBStrain00003876
Source Database: WormBase (WB)
Affected Genes: WBGene00001159(eff-1)
Genomic Alteration: WBGene00001159(eff-1)
Availability: available
Synonyms: eff-1(hy21) II; hyEx22.
Alternate IDs: WB-STRAIN:BP175, CGC_BP175
Notes: hyEx22 [hsp16-2::eff-1 + ajm-1::GFP + rol-6(su1006)]. Temperature sensitive eff-1 mutation (worms are cell fusion-defective at 25C; cell fusion defects are less penetrant at 15C). AJM-1 marks epithelial junctions. Pick GFP+ Rollers to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00003876 Copy
http://www.wormbase.org/db/get?name=WBStrain00003874
Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)|WBGene00001159(eff-1)
Genomic Alteration: WBGene00000100(ajm-1), WBGene00001159(eff-1)
Availability: available
Synonyms: eff-1(hy21) II; jcIs1 IV.
Alternate IDs: WB-STRAIN:BP76, CGC_BP76
Notes: jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
Proper citation: RRID:WB-STRAIN:WBStrain00003874 Copy
http://www.wormbase.org/db/get?name=WBStrain00003873
Source Database: WormBase (WB)
Affected Genes: WBGene00001159(eff-1)
Genomic Alteration: WBGene00001159(eff-1)
Availability: available
Synonyms: eff-1(hy21) II.
Alternate IDs: WB-STRAIN:BP75, CGC_BP75
Notes: Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain.
Proper citation: RRID:WB-STRAIN:WBStrain00003873 Copy
http://www.wormbase.org/db/get?name=WBStrain00003870
Source Database: WormBase (WB)
Availability: available
Synonyms: bqSi640 II; bqSi470 IV.
Alternate IDs: WB-STRAIN:BN646, CGC_BN646
Notes: bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively.
Proper citation: RRID:WB-STRAIN:WBStrain00003870 Copy
http://www.wormbase.org/db/get?name=WBStrain00003871
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; bqSi711 IV.
Alternate IDs: WB-STRAIN:BN711, CGC_BN711
Notes: bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https:|"Made_by: Javier Macas-Len"
Proper citation: RRID:WB-STRAIN:WBStrain00003871 Copy
http://www.wormbase.org/db/get?name=WBStrain00003890
Source Database: WormBase (WB)
Affected Genes: WBGene00004748(sdf-9)
Genomic Alteration: WBGene00004748(sdf-9)
Availability: available
Synonyms: sdf-9(mg337) V.
Alternate IDs: WB-STRAIN:BQ4, CGC_BQ4
Notes: Weak Hid. Eak.
Proper citation: RRID:WB-STRAIN:WBStrain00003890 Copy
http://www.wormbase.org/db/get?name=WBStrain00003808
Source Database: WormBase (WB)
Availability: available
Synonyms: ?(sc109) V.
Alternate IDs: WB-STRAIN:BE109, CGC_BE109
Notes: As homozygote suppresses blister formation in bli-1(sc73), bli-2(sc768) and bli-6(sc16). WT phenotype. Males sometimes have small blisters above their bursas. Males mate well. See wbg9.1p51.|"Made_by: M. Kusch"
Proper citation: RRID:WB-STRAIN:WBStrain00003808 Copy
http://www.wormbase.org/db/get?name=WBStrain00003803
Source Database: WormBase (WB)
Affected Genes: WBGene00004398(rol-8)
Genomic Alteration: WBGene00004398(rol-8)
Availability: available
Source References: PMID:3732788
Synonyms: rol-8(sc102) II.
Alternate IDs: WB-STRAIN:BE102, CGC_BE102
Notes: Made_by: R. Edgar|"Weak left-handed roller as adult."
Proper citation: RRID:WB-STRAIN:WBStrain00003803 Copy
http://www.wormbase.org/db/get?name=WBStrain00003887
Source Database: WormBase (WB)
Affected Genes: WBGene00000102(akt-1)
Genomic Alteration: WBGene00000102(akt-1)
Availability: available
Source References: PMID:38634692
Synonyms: akt-1(mg306) V.
Alternate IDs: WB-STRAIN:BQ1, CGC_BQ1
Notes: Hid.
Proper citation: RRID:WB-STRAIN:WBStrain00003887 Copy
http://www.wormbase.org/db/get?name=WBStrain00003881
Source Database: WormBase (WB)
Affected Genes: WBGene00016625(aff-1)
Genomic Alteration: WBGene00016625(aff-1)
Availability: available
Synonyms: hyEx167.
Alternate IDs: WB-STRAIN:BP395, CGC_BP395
Notes: hyEx167 [4.5kb aff-1p::GFP transcriptional fusion + rol-6(su1006)]. Shows cytoplasmic GFP expression in embryonic hyp5. In L1 hermaphrodite larva, aff-1::GFP is expressed in pharyngeal muscle 3 and 5, in sheath cells of chemosensory neurons, and in tail neurons. In L3 hermaphrodites, the transgene is expressed in the anchor cell; this expression proceeds in L4 along with expression in the utse cells, the seam cells and cells of vulval rings A and D. In adults, aff-1::GFP is expressed in the sheath cells of chemosensory neurons and in head interneurons, uterus toroids 2 and 4, in the vulva VulD, utse, and seam cells. Worms of hyEx167 are slightly Egl. Maintain by picking Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00003881 Copy
http://www.wormbase.org/db/get?name=WBStrain00003817
Source Database: WormBase (WB)
Affected Genes: WBGene00003401(mpk-1)
Genomic Alteration: WBGene00003401(mpk-1)
Availability: available
Source References: PMID:37122724
Synonyms: mpk-1(sbj10) III.
Alternate IDs: WB-STRAIN:BJS737, CGC_BJS737
Notes: Made_by: Julien N Bianco|"Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404."
Proper citation: RRID:WB-STRAIN:WBStrain00003817 Copy
http://www.wormbase.org/db/get?name=WBStrain00003813
Source Database: WormBase (WB)
Affected Genes: WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1)
Genomic Alteration: WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1)
Availability: available
Synonyms: scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X.
Alternate IDs: WB-STRAIN:BJ21, CGC_BJ21
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003813 Copy
http://www.wormbase.org/db/get?name=WBStrain00003810
Source Database: WormBase (WB)
Affected Genes: WBGene00004399(rol-9)
Genomic Alteration: WBGene00004399(rol-9)
Availability: available
Synonyms: rol-9(sc149) V.
Alternate IDs: WB-STRAIN:BE149, CGC_BE149
Notes: Strong right roller.
Proper citation: RRID:WB-STRAIN:WBStrain00003810 Copy
http://www.wormbase.org/db/get?name=WBStrain00003898
Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)|WBGene00000439(ceh-16)|WBGene00002980(lgg-1)
Genomic Alteration: WBGene00000100(ajm-1), WBGene00000439(ceh-16), WBGene00002980(lgg-1)
Availability: available
Synonyms: ceh-16(lg16) III; jcIs1 IV; ngEx1.
Alternate IDs: WB-STRAIN:BR2958, CGC_BR2958
Notes: jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061621 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003898 Copy
http://www.wormbase.org/db/get?name=WBStrain00003897
Source Database: WormBase (WB)
Affected Genes: WBGene00000500(chn-1)
Genomic Alteration: WBGene00000500(chn-1)
Availability: available
Source References: PMID:39384041
Synonyms: chn-1(by155) I.
Alternate IDs: WB-STRAIN:BR2823, CGC_BR2823
Notes: 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl"
Proper citation: RRID:WB-STRAIN:WBStrain00003897 Copy
http://www.wormbase.org/db/get?name=WBStrain00003894
Source Database: WormBase (WB)
Affected Genes: WBGene00003877(pept-1)
Genomic Alteration: WBGene00003877(pept-1)
Availability: available
Source References: PMID:33157031, PMID:38991033, PMID:39284915
Synonyms: pept-1(lg601) X.
Alternate IDs: WB-STRAIN:BR2742, CGC_BR2742
Notes: Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003894 Copy
http://www.wormbase.org/db/get?name=WBStrain00003829
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:34534446
Synonyms: inIs179 [ida-1p::GFP] II; him-8(e1489) IV
Alternate IDs: WB-STRAIN:BL5717, CGC_BL5717
Notes: inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00003829 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.