Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
BN544 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003864 | Caenorhabditis elegans | bqSi294 II; bqSi542 IV. | bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi542 [unc-47p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in GABAergic motor neurons and red nuclei elsewhere. | WB-STRAIN:WBStrain00003864 | WormBase (WB) | WB | available | WB-STRAIN:BN544, CGC_BN544 | WormBase | 2026-09-19 11:00:20 | 1 | |||||
|
BN507 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003861 | Caenorhabditis elegans | bqSi294 II; bqSi506 IV. | bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in neurons and red nuclei elsewhere.|"Supplementary_genotype bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV" | WB-STRAIN:WBStrain00003861 | WormBase (WB) | WB | available | PMID:36645076 PMID:37831769 |
WB-STRAIN:BN507, CGC_BN507 | WormBase | 2026-09-19 11:00:20 | 2 | ||||
|
BP221 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003878 | Caenorhabditis elegans | eff-1(hy21) II; hyEx23. | hyEx23 [des-2p::eff-1 + des-2::GFP + rol-6(su1006)]. Cell-specific expression of eff-1 in the PVDs. Partially rescues arborization Eff-1 phenotypes. Pick GFP+ Rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8. | WBGene00001159(eff-1) | WBGene00001159(eff-1) | WB-STRAIN:WBStrain00003878 | WormBase (WB) | WB | available | WB-STRAIN:BP221, CGC_BP221 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BP175 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003876 | Caenorhabditis elegans | eff-1(hy21) II; hyEx22. | hyEx22 [hsp16-2::eff-1 + ajm-1::GFP + rol-6(su1006)]. Temperature sensitive eff-1 mutation (worms are cell fusion-defective at 25C; cell fusion defects are less penetrant at 15C). AJM-1 marks epithelial junctions. Pick GFP+ Rollers to maintain. | WBGene00001159(eff-1) | WBGene00001159(eff-1) | WB-STRAIN:WBStrain00003876 | WormBase (WB) | WB | available | WB-STRAIN:BP175, CGC_BP175 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BP76 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003874 | Caenorhabditis elegans | eff-1(hy21) II; jcIs1 IV. | jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90. | WBGene00000100(ajm-1)|WBGene00001159(eff-1) | WBGene00000100(ajm-1), WBGene00001159(eff-1) | WB-STRAIN:WBStrain00003874 | WormBase (WB) | WB | available | WB-STRAIN:BP76, CGC_BP76 | WormBase | 2026-09-19 11:00:20 | 1 | |||
|
BP75 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003873 | Caenorhabditis elegans | eff-1(hy21) II. | Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain. | WBGene00001159(eff-1) | WBGene00001159(eff-1) | WB-STRAIN:WBStrain00003873 | WormBase (WB) | WB | available | WB-STRAIN:BP75, CGC_BP75 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BN646 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003870 | Caenorhabditis elegans | bqSi640 II; bqSi470 IV. | bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively. | WB-STRAIN:WBStrain00003870 | WormBase (WB) | WB | available | WB-STRAIN:BN646, CGC_BN646 | WormBase | 2026-09-19 11:00:20 | 0 | |||||
|
BN711 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003871 | Caenorhabditis elegans | unc-119(ed3) III; bqSi711 IV. | bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https:|"Made_by: Javier Macas-Len" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00003871 | WormBase (WB) | WB | available | WB-STRAIN:BN711, CGC_BN711 | WormBase | 2026-09-19 11:00:20 | 2 | |||
|
BQ4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003890 | Caenorhabditis elegans | sdf-9(mg337) V. | Weak Hid. Eak. | WBGene00004748(sdf-9) | WBGene00004748(sdf-9) | WB-STRAIN:WBStrain00003890 | WormBase (WB) | WB | available | WB-STRAIN:BQ4, CGC_BQ4 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BE109 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003808 | Caenorhabditis elegans | ?(sc109) V. | As homozygote suppresses blister formation in bli-1(sc73), bli-2(sc768) and bli-6(sc16). WT phenotype. Males sometimes have small blisters above their bursas. Males mate well. See wbg9.1p51.|"Made_by: M. Kusch" | WB-STRAIN:WBStrain00003808 | WormBase (WB) | WB | available | WB-STRAIN:BE109, CGC_BE109 | WormBase | 2026-09-19 11:00:19 | 0 | |||||
|
BE102 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003803 | Caenorhabditis elegans | rol-8(sc102) II. | Made_by: R. Edgar|"Weak left-handed roller as adult." | WBGene00004398(rol-8) | WBGene00004398(rol-8) | WB-STRAIN:WBStrain00003803 | WormBase (WB) | WB | available | PMID:3732788 | WB-STRAIN:BE102, CGC_BE102 | WormBase | 2026-09-19 11:00:19 | 0 | ||
|
BQ1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003887 | Caenorhabditis elegans | akt-1(mg306) V. | Hid. | WBGene00000102(akt-1) | WBGene00000102(akt-1) | WB-STRAIN:WBStrain00003887 | WormBase (WB) | WB | available | PMID:38634692 | WB-STRAIN:BQ1, CGC_BQ1 | WormBase | 2026-09-19 11:00:20 | 1 | ||
|
BP395 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003881 | Caenorhabditis elegans | hyEx167. | hyEx167 [4.5kb aff-1p::GFP transcriptional fusion + rol-6(su1006)]. Shows cytoplasmic GFP expression in embryonic hyp5. In L1 hermaphrodite larva, aff-1::GFP is expressed in pharyngeal muscle 3 and 5, in sheath cells of chemosensory neurons, and in tail neurons. In L3 hermaphrodites, the transgene is expressed in the anchor cell; this expression proceeds in L4 along with expression in the utse cells, the seam cells and cells of vulval rings A and D. In adults, aff-1::GFP is expressed in the sheath cells of chemosensory neurons and in head interneurons, uterus toroids 2 and 4, in the vulva VulD, utse, and seam cells. Worms of hyEx167 are slightly Egl. Maintain by picking Rollers. | WBGene00016625(aff-1) | WBGene00016625(aff-1) | WB-STRAIN:WBStrain00003881 | WormBase (WB) | WB | available | WB-STRAIN:BP395, CGC_BP395 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BJS737 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003817 | Caenorhabditis elegans | mpk-1(sbj10) III. | Made_by: Julien N Bianco|"Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404." | WBGene00003401(mpk-1) | WBGene00003401(mpk-1) | WB-STRAIN:WBStrain00003817 | WormBase (WB) | WB | available | PMID:37122724 | WB-STRAIN:BJS737, CGC_BJS737 | WormBase | 2026-09-19 11:00:19 | 1 | ||
|
BJ21 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003813 | Caenorhabditis elegans | scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X. | EMPTY | WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1) | WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1) | WB-STRAIN:WBStrain00003813 | WormBase (WB) | WB | available | WB-STRAIN:BJ21, CGC_BJ21 | WormBase | 2026-09-19 11:00:19 | 1 | |||
|
BE149 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003810 | Caenorhabditis elegans | rol-9(sc149) V. | Strong right roller. | WBGene00004399(rol-9) | WBGene00004399(rol-9) | WB-STRAIN:WBStrain00003810 | WormBase (WB) | WB | available | WB-STRAIN:BE149, CGC_BE149 | WormBase | 2026-09-19 11:00:19 | 0 | |||
|
BR2958 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00003898 | Caenorhabditis elegans | ceh-16(lg16) III; jcIs1 IV; ngEx1. | jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061621 added based on AFP_Strain data." | WBGene00000100(ajm-1)|WBGene00000439(ceh-16)|WBGene00002980(lgg-1) | WBGene00000100(ajm-1), WBGene00000439(ceh-16), WBGene00002980(lgg-1) | WB-STRAIN:WBStrain00003898 | WormBase (WB) | WB | available | WB-STRAIN:BR2958, CGC_BR2958 | WormBase | 2026-09-19 11:00:20 | 0 | |||
|
BR2823 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003897 | Caenorhabditis elegans | chn-1(by155) I. | 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl" | WBGene00000500(chn-1) | WBGene00000500(chn-1) | WB-STRAIN:WBStrain00003897 | WormBase (WB) | WB | available | PMID:39384041 | WB-STRAIN:BR2823, CGC_BR2823 | WormBase | 2026-09-19 11:00:20 | 2 | ||
|
BR2742 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003894 | Caenorhabditis elegans | pept-1(lg601) X. | Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data." | WBGene00003877(pept-1) | WBGene00003877(pept-1) | WB-STRAIN:WBStrain00003894 | WormBase (WB) | WB | available | PMID:33157031 PMID:38991033 PMID:39284915 |
WB-STRAIN:BR2742, CGC_BR2742 | WormBase | 2026-09-19 11:00:20 | 3 | ||
|
BL5717 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00003829 | Caenorhabditis elegans | inIs179 [ida-1p::GFP] II; him-8(e1489) IV | inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays" | WBGene00001867(him-8) | WBGene00001867(him-8) | WB-STRAIN:WBStrain00003829 | WormBase (WB) | WB | available | PMID:34534446 | WB-STRAIN:BL5717, CGC_BL5717 | WormBase | 2026-09-19 11:00:19 | 2 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
