Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2307442
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2307442, 2307442, RRRC_451, RRRC_0451, RRRC_00451
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00451 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2304201
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2304201, 2304201, RRRC_450, RRRC_0450, RRRC_00450
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene. Rat Resource & Research Center
Proper citation: RRID:RRRC_00450 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2302662
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2302662, 2302662, RRRC_372, RRRC_0372, RRRC_00372
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00372 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299144
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2299144, 2299144, RRRC_368, RRRC_0368, RRRC_00368
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00368 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=6478788
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-04-16)
Alternate IDs: RGD_6478788, 6478788, RRRC_485, RRRC_0485, RRRC_00485
Notes: This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats. Rat Resource and Research Center
Proper citation: RRID:RRRC_00485 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2311694
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2311694, 2311694, RRRC_484, RRRC_0484, RRRC_00484
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. Rat Resource & Research Center
Proper citation: RRID:RRRC_00484 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2313465
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2313465, 2313465, RRRC_483, RRRC_0483, RRRC_00483
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00483 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2314339
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2314339, 2314339, RRRC_480, RRRC_0480, RRRC_00480
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. Rat Resource & Research Center
Proper citation: RRID:RRRC_00480 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299133
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2299133, 2299133, RRRC_357, RRRC_0357, RRRC_00357
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00357 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2311692
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2311692, 2311692, RRRC_478, RRRC_0478, RRRC_00478
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00478 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2303977
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2303977, 2303977, RRRC_477, RRRC_0477, RRRC_00477
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. Rat Resource & Research Center
Proper citation: RRID:RRRC_00477 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299148
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2299148, 2299148, RRRC_355, RRRC_0355, RRRC_00355
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. Rat Resource & Research Center
Proper citation: RRID:RRRC_00355 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299135
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: RGD_2299135, 2299135, RRRC_354, RRRC_0354, RRRC_00354
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. Rat Resource and Research Center
Proper citation: RRID:RRRC_00354 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13702080
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery (as of 2019-01-21)
Alternate IDs: RGD_13702080, 13702080, RRRC_831, RRRC_0831, RRRC_00831
Notes: CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. Rat Resource and Research Center
Proper citation: RRID:RRRC_00831 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=12738466
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-06)
Alternate IDs: RGD_12738466, 12738466, RRRC_542, RRRC_0542, RRRC_00542
Notes: Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains. Rat Resource and Research Center
Proper citation: RRID:RRRC_00542 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=14695029
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: RGD_14695029, 14695029, RRRC_848, RRRC_0848, RRRC_00848
Notes: This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 7.5kb 5' and 1.6kb 3' homology arm. A FRT-CAG-EGFP-IRES-Pac-FRT cassette is inserted into the intron between 8th and 9th exons of Kcnh2 gene. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain Rat Resource and Research Center
Proper citation: RRID:RRRC_00848 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11087553
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm; Cryorecovery (as of 2017-08-10)
Alternate IDs: RGD_11087553, 11087553, RRRC_770, RRRC_0770, RRRC_00770
Notes: TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon Rat Resource and Research Center
Proper citation: RRID:RRRC_00770 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=150520182
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Live Animals (as of 2023-08-01)
Alternate IDs: RGD_150520182, 150520182, RRRC_938, RRRC_0938, RRRC_00938
Notes: The DNA construct was made by replacing ZsGreen with TdTomato in plasmid pCAG-loxP-STOP-loxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). CRISPR/Cas9 genome editing technology was used to knock in the DNA construct into the rat ROSA26 locus in the embryos from outbred BluHsd:LE. Reporter line that can be crossed with Cre-expressing strains. In presence of Cre, the floxed "STOP" upstream of the TdTomato gene is deleted allowing expression of the red fluorescent TdTomato protein. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Rat Resource and Research Center
Proper citation: RRID:RRRC_00938 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=12743623
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-02-10)
Alternate IDs: RGD_12743623, 12743623, RRRC_783, RRRC_0783, RRRC_00783
Notes: The phenotype of the BN.F344-ApcPirc congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tumor development and can live over 2 years. Rat Resource and Research Center
Proper citation: RRID:RRRC_00783 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=12743627
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-02-10)
Alternate IDs: RGD_12743627, 12743627, RRRC_702, RRRC_0702, RRRC_00702
Notes: inbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River. Rat Resource and Research Center
Proper citation: RRID:RRRC_00702 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.