Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00036117

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003225(mev-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003225(mev-1)
Availability: available
Synonyms: mev-1(ok909) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC848, CGC_VC848
Notes: Made_by: Anna Rankin|"Mutagen:UV/TMP"|"T07C4.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok909 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036117 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036129

Source Database: WormBase (WB)
Affected Genes: WBGene00000501(cho-1)
Genomic Alteration: WBGene00000501(cho-1)
Availability: available
Synonyms: cho-1(ok1069) IV.
Alternate IDs: WB-STRAIN:VC862, CGC_VC862
Notes: C48D1.3. Superficially wild type.|"C48D1.3. Superficially wild type. [NOTE: (06/13/2017) A user has reported that they are unable to identify only ok1069 animals by PCR, so it is possible that this strain carries a deletion/duplication.]"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036129 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036107

Source Database: WormBase (WB)
Affected Genes: WBGene00000241(bbs-1)
Genomic Alteration: WBGene00000241(bbs-1)
Availability: available
Source References: PMID:38302462
Synonyms: bbs-1(ok1111) I.
Alternate IDs: WB-STRAIN:VC837, CGC_VC837
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y105E8A.5. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00036107 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036158

Source Database: WormBase (WB)
Affected Genes: WBGene00000390(cdc-42)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000390(cdc-42), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38190406
Synonyms: cdc-42(gk388)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC898, CGC_VC898
Notes: Mutagen:UV/TMP|"R07G3.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes (sterile adult with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036158 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036256

Source Database: WormBase (WB)
Affected Genes: WBGene00003967(pdr-1)
Genomic Alteration: WBGene00003967(pdr-1)
Availability: available
Source References: PMID:36653384
Synonyms: pdr-1(gk448) III.
Alternate IDs: WB-STRAIN:VC1024, CGC_VC1024
Notes: K08E3.7. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036256 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036258

Source Database: WormBase (WB)
Affected Genes: WBGene00004273(rab-10)
Genomic Alteration: WBGene00004273(rab-10)
Availability: available
Source References: PMID:38302462
Synonyms: rab-10(ok1494) I.
Alternate IDs: WB-STRAIN:VC1026, CGC_VC1026
Notes: Mutagen:UV/TMP|"T23H2.5. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036258 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036261

Source Database: WormBase (WB)
Affected Genes: WBGene00003085(ccar-1)
Genomic Alteration: WBGene00003085(ccar-1)
Availability: available
Synonyms: ccar-1(gk433) IV.
Alternate IDs: WB-STRAIN:VC1029, CGC_VC1029
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y37A1B.1a. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00036261 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036232

Source Database: WormBase (WB)
Affected Genes: WBGene00002131(inx-9)
Genomic Alteration: WBGene00002131(inx-9)
Availability: available
Synonyms: inx-9(ok1502) IV.
Alternate IDs: WB-STRAIN:VC994, CGC_VC994
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK792.3. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00036232 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036241

Source Database: WormBase (WB)
Affected Genes: WBGene00006912(vha-3)
Genomic Alteration: WBGene00006912(vha-3)
Availability: available
Source References: PMID:32302543, PMID:37644339, PMID:37957360
Synonyms: vha-3(ok1501) IV.
Alternate IDs: WB-STRAIN:VC1003, CGC_VC1003
Notes: Mutagen:UV/TMP|"Supplementary_genotype vha-3(ok1501) IV"|"Supplementary_genotype [vha-3(ok1501)]"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."|"Y38F2AL.4. Superficially wild type. External left primer: GGTGAAAAATCGGGGAAAAT. External right primer: GCGATGACAACTATTGGGCT. Internal left primer: TTTAGCTCAAAATTTGCCCG. Internal right primer: ATGTGCTGCGACTTCCTTCT. Internal WT amplicon: 2580 bp. Deletion size: 710 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00036241 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036246

Source Database: WormBase (WB)
Affected Genes: WBGene00016943(acdh-1)
Genomic Alteration: WBGene00016943(acdh-1)
Availability: available
Source References: PMID:32560629, PMID:37043428, PMID:38418585
Synonyms: acdh-1(ok1489) I.
Alternate IDs: WB-STRAIN:VC1011, CGC_VC1011
Notes: C55B7.4. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036246 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036219

Source Database: WormBase (WB)
Affected Genes: WBGene00007615(set-31)
Genomic Alteration: WBGene00007615(set-31)
Availability: available
Synonyms: set-31(ok1482) V.
Alternate IDs: WB-STRAIN:VC978, CGC_VC978
Notes: C15H11.5. Superficially wild type.|"Made_by: Anna Rankin"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036219 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036213

Source Database: WormBase (WB)
Affected Genes: WBGene00000067(act-5)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000067(act-5), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38190406
Synonyms: +/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC971, CGC_VC971
Notes: Mutagen:UV/TMP|"T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036213 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036222

Source Database: WormBase (WB)
Affected Genes: WBGene00001835(hda-2)
Genomic Alteration: WBGene00001835(hda-2)
Availability: available
Synonyms: hda-2(ok1479) II.
Alternate IDs: WB-STRAIN:VC983, CGC_VC983
Notes: C08B11.2. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036222 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036221

Source Database: WormBase (WB)
Affected Genes: WBGene00001499(fsn-1)
Genomic Alteration: WBGene00001499(fsn-1)
Availability: available
Synonyms: fsn-1(gk429) III.
Alternate IDs: WB-STRAIN:VC980, CGC_VC980
Notes: C26E6.5. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036221 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036293

Source Database: WormBase (WB)
Affected Genes: WBGene00022516(mtx-2)
Genomic Alteration: WBGene00022516(mtx-2)
Availability: available
Synonyms: mtx-2(gk444) III.
Alternate IDs: WB-STRAIN:VC1064, CGC_VC1064
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC97.1. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00036293 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036292

Source Database: WormBase (WB)
Affected Genes: WBGene00003753(nlp-15)
Genomic Alteration: WBGene00003753(nlp-15)
Availability: available
Source References: PMID:38573858
Synonyms: nlp-15(ok1512) I.
Alternate IDs: WB-STRAIN:VC1063, CGC_VC1063
Notes: CC4.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036292 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036359

Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: available
Source References: PMID:31704915
Synonyms: trp-4(ok1605) I.
Alternate IDs: WB-STRAIN:VC1141, CGC_VC1141
Notes: Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y71A12B.4. Superficially wild type. External left primer: AAGACTCCGGTACACGTTGC. External right primer: AGAAGCATCCGCACAAGACT. Internal left primer: AAGTTTGGTGGCTCAATTCG. Internal right primer: CTTTGAGCGGCTAAATGGAG. Internal WT amplicon: 3332 bp. Deletion size: 1027 bp. Deletion left flank: GGCCGAGGTTACTGGACCAGGACCAGGGCC. Deletion right flank: TTTTACCGATTTTTAGGCAGAATTGATTTT."

Proper citation: RRID:WB-STRAIN:WBStrain00036359 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00036319

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008877(rtcb-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008877(rtcb-1)
Availability: available
Source References: PMID:33157031
Synonyms: rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1094, CGC_VC1094
Notes: F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036319 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037912

Source Database: WormBase (WB)
Affected Genes: WBGene00000714(col-141)
Genomic Alteration: WBGene00000714(col-141)
Availability: available
Synonyms: col-141(gk5185) V.
Alternate IDs: WB-STRAIN:VC4094, CGC_VC4094
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037912 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038146

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20204, CGC_VC20204
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038146 Copy   

•   Source: WormBase