SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 1,458 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_5688030

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688030

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Genomic Alteration: (null)
Availability: Unknown
Source References: (null)
Alternate IDs: 5688030
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688030 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329969885
Notes: The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype.

Proper citation: RRID:RGD_329969885 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401795481

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11)
Alternate IDs: 401795481
Notes: The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan.

Proper citation: RRID:RGD_401795481 Copy   


  • RRID:RGD_598092575

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092575

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-27)
Alternate IDs: 598092575
Notes: This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092575 Copy   


  • RRID:RGD_598092509

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092509

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-03-21)
Alternate IDs: 598092509
Notes: Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 Availability Contact Email: [email protected] at Augusta University

Proper citation: RRID:RGD_598092509 Copy   


  • RRID:RGD_598092583

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092583

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092583
Notes: Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092583 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092585

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092585
Notes: The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092585 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092582

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092582
Notes: Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). Cre and T2A were inserted into the start codon (methionine) of the second exon of the Calca gene using CRISPR/Cas9. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092582 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154594

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154594
Notes: Zinc fingers were designed and human C5aR1 cDNA was cloned into a pZFN plasmid and sequence verified. Subsequently, co-microinjection of a pair of ZFNs and the donor plasmid into the pronucleus of fertilized, one cell embryos was performed, generating HR-mediated KI animals. The entire process was performed at SAGE Labs, Horizon, (St Louis, USA). Sprague Dawley (Charles River) rat (Rattus norvegicus) C5aR1 (NCBI Gene ID: 113959, updated on 18-Oct-2012 Location : 1q12 Sequence : Chromosome: 1; NC_005100.3 (79452051..79458856, complement) mRNA join (1..>34,5088..6806) /gene="C5ar1" CDS join(32..34,5088..6143) /gene="C5ar1") was replaced using zinc finger technology utilizing with the human C5aR1 cDNA by inserting the human cDNA into the 5’ end of the rat C5ar1 exon 2 locus using the ZFN Binding. Cut Site: CTTGGCCGTGTTCCTGGTaggagtTACCGGAAATGCCCTGGTG National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598154594 Copy   


  • RRID:RGD_598092598

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092598

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092598
Notes: A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092598 Copy   


  • RRID:RGD_598092597

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092597

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092597
Notes: Generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092597 Copy   


  • RRID:RGD_598092526

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092526

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-25)
Alternate IDs: 598092526
Notes: This strain was established in 2020 using the CRISPR/Cas9 system at the Institute of Immunology Co., Ltd. In the same year, it was introduced to the Research Institute, National Cerebral and Cardiovascular Center. The genetic background is Slc:SD. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092526 Copy   


  • RRID:RGD_598092522

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092522

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-25)
Alternate IDs: 598092522
Notes: Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. In 2000, it was provided to Japan SLC, Inc.The mutant beige protein was frameshift and prematured truncated at the 2594th amino acids due to 578 bp deletion (positions 7742-8319) caused by recombination between LINE1s (Long Interspersed Nuclear Element 1). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_598092522 Copy   


  • RRID:RGD_407420261

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407420261

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 407420261
Notes: The CRISPR/Cas9 nuclease system was used to generate Sprague Dawley (SD) rats with Nme7 gene knock-out. Two sets of guide (g)RNA were designed within the exon 4 of the Nme7 gene. A knock-out founder with a 5-nucleotide deletion (TCGAA within the exon 4 of the Nme7 gene) creating a premature stop codon.

Proper citation: RRID:RGD_407420261 Copy   


  • RRID:RGD_405849409

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849409

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849409
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a wild type littermate used as the control for its homozygous or heterozygous littermate. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_405849409 Copy   


  • RRID:RGD_407420262

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407420262

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 407420262
Notes: The CRISPR/Cas9 nuclease system was used to generate Sprague Dawley (SD) rats with Nme7 gene knock-out. Two sets of guide (g)RNA were designed within the exon 4 of the Nme7 gene. A knock-out founder with a 5-nucleotide deletion (TCGAA within the exon 4 of the Nme7 gene) creating a premature stop codon.

Proper citation: RRID:RGD_407420262 Copy   


  • RRID:RGD_407571697

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407571697

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 407571697
Notes: CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) Strain deposited with the RRRC

Proper citation: RRID:RGD_407571697 Copy   


  • RRID:RGD_405849382

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849382

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849382
Notes: This is the wild type littermate of the Tti2 knockout rats. The knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and this wild type littermates were used as controls.

Proper citation: RRID:RGD_405849382 Copy   


  • RRID:RGD_405100725

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100725

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100725
Notes: This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. Optogenetics and Transgenic Technology Core

Proper citation: RRID:RGD_405100725 Copy   


  • RRID:RGD_408364955

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364955

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2024-11-05)
Alternate IDs: 408364955
Notes: The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt--del--- GAGTGTGTGGAGACCGAGCCAC This strain is deposited to Rat Resource and Research Center (RRRC)

Proper citation: RRID:RGD_408364955 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X