Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Cyp27b1em2Hfd Resource Report Resource Website |
RRID:RGD_408364959 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG Rat Resource and Research Center (RRRC); strain ID 1032 | 408364959 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2024-11-05) | 408364959 | 2026-09-19 01:18:56 | 0 | |||||
|
ZFDM-Lcn2em2Nyo Resource Report Resource Website |
RRID:RGD_598154608 | Rattus norvegicus | "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " National BioResource Project for the Rat in Japan | 598154608 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154608 | 2026-09-19 01:18:57 | 0 | |||||
|
LE-Galem2(cre)Davis Resource Report Resource Website |
RRID:RGD_407431637 | Rattus norvegicus | This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Gal. Created by Daniel Davis at University of Missouri. Deposited at RRRC. Deposited at RRRC. Contact [email protected] for availability. | 407431637 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-08-15) | 407431637 | 2026-09-19 01:18:56 | 0 | |||||
|
F344-Rag2em1Larc Resource Report Resource Website |
RRID:RGD_598154600 | Rattus norvegicus | This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 410 bp deletion in the Rag2 gene was established from the resulting litters. National BioResource Project for the Rat in Japan | 598154600 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-04-30) | 598154600 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Il6em1Yona+/+ Resource Report Resource Website |
RRID:RGD_407450414 | Rattus norvegicus | The wild type rats were littermates of cross of heterozygous Il6 mutant rats. The wild type littermates were used as experimental controls for the homozygous mutant SD-Il6em1Yona-/- (RGD:407450413) generated using the CRISPR/Cas9 technique to induce a 118 bp deletion in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan | 407450414 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 407450414 | 2026-09-19 01:18:56 | 0 | |||||
|
LE-Drd3em3(cre)Davis Resource Report Resource Website |
RRID:RGD_407431636 | Rattus norvegicus | This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Drd3. Deposited at RRRC. Contact [email protected] for availability. | 407431636 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-08-15) | 407431636 | 2026-09-19 01:18:56 | 0 | |||||
|
LE-Drd3em2(cre)Davis Resource Report Resource Website |
RRID:RGD_407431635 | Rattus norvegicus | CRISPR/Cas9 was used to insert CRE recombinase at DRD3 in rat embryos.This is line2, and line1 is "LE-DRD3em1(cre)Davis" (RGD:407431632). Both are created by Daniel Davis at University of Missouri for the Section on Behavioral Neuroscience at NIMH. Deposited at RRRC. Contact [email protected] for availability. | 407431635 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-08-15) | 407431635 | 2026-09-19 01:18:56 | 0 | |||||
|
WKY-Krtcap3em3Mcwi-/- Resource Report Resource Website |
RRID:RGD_19165362 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/NCrl rat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene, which led to a frameshift mutation and early termination of the KRTCAP3 protein. Contact MCW rat distribution at [email protected] | 19165362 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 19165362 | 2026-09-19 01:18:56 | 0 | |||||
|
WKY-Adcy3em3Mcwi-/- Resource Report Resource Website |
RRID:RGD_639699398 | Rattus norvegicus | Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062).The homozygous mutant was lethal shortly after birth, so the heterozygous +/- (RGD:19165366) was used for breeding and study. Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected] | 639699398 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 639699398 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Ghrhem1Mcwi Resource Report Resource Website |
RRID:RGD_329849114 | Rattus norvegicus | The CRISPR/SpCas9 system was used to introduce a 10-bp deletion (rn6: chr3:153,453,801-153,453,810) in exon 3 of the Ghrh gene in Crl:SD Sprague Dawley embryos. | 329849114 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329849114 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-(ROSA)26 Sorem1(CAG-tdTomato)Cya Resource Report Resource Website |
RRID:RGD_632518357 | Rattus norvegicus | The endonuclease mediated knock in of the transgenic cassette, CAG-LSL-tdTomato in mouse (ROSA)26Sor, was created in Crl:CD (SD) rats. Cyagen | 632518357 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-02-06) | 632518357 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Antxr2 em1/Vr Resource Report Resource Website |
RRID:RGD_629006637 | Rattus norvegicus | ANTXR2 knock-out rats were generated using CRISPR/Cas9-mediated genome editing. Specifically, a 67 base pairs deletion in exon 1 of ANTXR2 was induced by 2 guide RNAs targeting sequences within exon 1. The guide RNA targeting vectors and Cas9 were co-injected into the fertilized Sprague Dawley eggs to generate ANTXR2 knock-out rats. The pups were genotyped by PCR and confirmed by sequencing (forward primer: 5′-TTGGGTGGCTCTGAGCTTGGA-3′, reverse primer: 5′-AGGGGTCTAGGGGAGTGTGATAAAGA-3′). | 629006637 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 629006637 | 2026-09-19 01:18:57 | 0 | |||||
|
SS-ROSA26em1(CAG-tdTomato)1Sage/Mcwi Resource Report Resource Website |
RRID:RGD_25394534 | Rattus norvegicus | LE-ROSA26em1(CAG-tdTomato)1Sage (RGDID: 12905037) was backcrossed to SS/JrHsdMcwi for more than 8 generations. Contact MCW rat distribution at [email protected] | 25394534 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25394534 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Adh5em1Mcwi Resource Report Resource Website |
RRID:RGD_152998996 | Rattus norvegicus | This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 mutagenesis in Crl:SD strain and harbors a 16-bp deletion in exon 3 of Adh5. rn6.0:chr2:226,979,096-226,979,111. contact MCW Rat Distribution at [email protected] | 152998996 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2022-07-15) | 152998996 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Ager em2Mcwi Resource Report Resource Website |
RRID:RGD_152998993 | Rattus norvegicus | This model was produced at the Medical College of Wisconsin using CRISPR/Cas9 in the Crl:SD strain. The resulting mutation is a 1-bp insertion in the third exon of the Ager gene. rn6.0:chr20:4,150,403-4,150,403 ins T contact MCW Rat Distribution at [email protected] | 152998993 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2022-07-15) | 152998993 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Galtem3Mcwi+/- Resource Report Resource Website |
RRID:RGD_632645231 | Rattus norvegicus | This is a heterozygous Galt mutant rat carries one copy of CRISPR/Cas9 system induced 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos. | 632645231 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 632645231 | 2026-09-19 01:18:58 | 0 | |||||
|
WI-Ugt2em1Yakaz Resource Report Resource Website |
RRID:RGD_625777899 | Rattus norvegicus | To produce Ugt2 cluster (∼762-kb) KO rats, two gRNAs with target sites upstream of Ugt2a1 and the coding region of Ugt2b31-like were injected into rat fertilized eggs. A knockout strain with Ugt2 cluster mutation carried concatenation of the genomic sequence upstream of Ugt2a1, a 102-bp insertion, and the Ugt2b31-like region. The F2 homozygous rats showed decreased gemfibrozil glucuronidation activity in the liver. The result suggested the functional deletion of rat Ugt2 genes in the Ugt2-KO rats. | 625777899 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 625777899 | 2026-09-19 01:18:57 | 0 | |||||
|
LE-Cdkl5em1Sidb Resource Report Resource Website |
RRID:RGD_626170603 | Rattus norvegicus | In collaboration with Horizon Discovery, CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 626170603 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-09-02) | 626170603 | 2026-09-19 01:18:57 | 0 | |||||
|
LE-Elovl4 em1cgen-/- Resource Report Resource Website |
RRID:RGD_617154644 | Rattus norvegicus | The CRISPR/Cas9 genetic editing approach was used to generate .a homozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines. | 617154644 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 617154644 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Dp(Sult1a1-Spn)/YahIcsOrl Resource Report Resource Website |
RRID:RGD_626168271 | Rattus norvegicus | Sprague Dawley rat. Tandem duplication of the genetic interval between Sult1a1 and Spn genes using CRISPR/Cas9 engineering. We targeted the genetic interval borders from one allele and the CRISPR/Cas9 system allowed us to cut and transpose those sequences to the same locus on the second allele. Heterozygous animals are Overweight and hypoactivity. European Mouse Mutant Archive(EMMA) | 626168271 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryorecovery (as of 2025-08-29) | 626168271 | 2026-09-19 01:18:57 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
