Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00050730
Source Database: WormBase (WB)
Availability: unknown
Synonyms: vxIs824; vxIs591.
Notes: Made_by: Wisath Sae-Lee|"vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938"
Proper citation: RRID:WB-STRAIN:WBStrain00050730 Copy
http://www.wormbase.org/db/get?name=WBStrain00050842
Source Database: WormBase (WB)
Availability: unknown
Synonyms: otIs439; hdIs32.
Notes: Made_by: Oliver Hobert Lab|"otIs439 [lad-2p::GFP + pha-1(+)]. hdIs32 [glr-1::DsRed2]. SMD neurons are labeled with GFP and DsRed2. Can be used to isolate SMD by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00050842 Copy
http://www.wormbase.org/db/get?name=WBStrain00051278
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Synonyms: F32D1.7(gk5667[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Notes: Homozygous viable. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATATATACACGAATGTCATTTAGTCGG. Right flanking sequence: CCTGGCACGGCAAAACAAAATTAGCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051278 Copy
http://www.wormbase.org/db/get?name=WBStrain00051266
Source Database: WormBase (WB)
Affected Genes: WBGene00000230(atp-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000230(atp-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Synonyms: atp-3(gk5653[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1382 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTGTTTTCTTTCAAAACATTATTAAGAAGT. Right flanking sequence: TGGCTGAGTATCACTCTCTTAACCATAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051266 Copy
http://www.wormbase.org/db/get?name=WBStrain00051521
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-2(e1308ts) II
Notes: Supplementary_genotype bli-2(e1308ts) II
Proper citation: RRID:WB-STRAIN:WBStrain00051521 Copy
http://www.wormbase.org/db/get?name=WBStrain00051520
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-2(e1027) II
Notes: Supplementary_genotype bli-2(e1027) II
Proper citation: RRID:WB-STRAIN:WBStrain00051520 Copy
http://www.wormbase.org/db/get?name=WBStrain00051515
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-1(e944) II
Notes: Supplementary_genotype bli-1(e944) II
Proper citation: RRID:WB-STRAIN:WBStrain00051515 Copy
http://www.wormbase.org/db/get?name=WBStrain00051514
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-2(e772) II
Notes: Supplementary_genotype bli-2(e772) II
Proper citation: RRID:WB-STRAIN:WBStrain00051514 Copy
http://www.wormbase.org/db/get?name=WBStrain00051518
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-1(e1610) II
Notes: Supplementary_genotype bli-1(e1610) II
Proper citation: RRID:WB-STRAIN:WBStrain00051518 Copy
http://www.wormbase.org/db/get?name=WBStrain00051517
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-1(e1431) II
Notes: Supplementary_genotype bli-1(e1431) II
Proper citation: RRID:WB-STRAIN:WBStrain00051517 Copy
http://www.wormbase.org/db/get?name=WBStrain00051516
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37980413
Synonyms: bli-1(e976) II
Notes: Supplementary_genotype bli-1(e976) II
Proper citation: RRID:WB-STRAIN:WBStrain00051516 Copy
http://www.wormbase.org/db/get?name=WBStrain00051503
Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: unknown
Synonyms: enIs74 II; unc-76(e911) V.
Notes: enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) eat me signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.|"Made_by: Henry He"
Proper citation: RRID:WB-STRAIN:WBStrain00051503 Copy
http://www.wormbase.org/db/get?name=WBStrain00051652
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Synonyms: unc-119(ox819 oxTi1126) III.
Notes: oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00051652 Copy
http://www.wormbase.org/db/get?name=WBStrain00051713
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34865044
Synonyms: osIs158 II.
Notes: Made_by: Takefumi Negishi|"osIs158 [eft-3p::AtTIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218."
Proper citation: RRID:WB-STRAIN:WBStrain00051713 Copy
http://www.wormbase.org/db/get?name=WBStrain00051719
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Synonyms: qIs56 him-5(e1490) V; qEx557.
Notes: qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
Proper citation: RRID:WB-STRAIN:WBStrain00051719 Copy
http://www.wormbase.org/db/get?name=WBStrain00051808
Source Database: WormBase (WB)
Affected Genes: WBGene00003387(mod-5)
Genomic Alteration: WBGene00003387(mod-5)
Availability: unknown
Synonyms: mod-5(vlc47[mod-5::T2A::mNeonGreen]) I.
Notes: Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"
Proper citation: RRID:WB-STRAIN:WBStrain00051808 Copy
http://www.wormbase.org/db/get?name=WBStrain00051847
Source Database: WormBase (WB)
Affected Genes: WBGene00002092(ins-9)
Genomic Alteration: WBGene00002092(ins-9)
Availability: unknown
Source References: PMID:37935195
Synonyms: ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X.
Notes: Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.|"Supplementary_genotype ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X"
Proper citation: RRID:WB-STRAIN:WBStrain00051847 Copy
http://www.wormbase.org/db/get?name=WBStrain00053918
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37528117
Synonyms: ccIs4251, aceIs1, immt-1(tm1730), ATU3308: ccIs4251, aceIs1, immt-2(tm2366)
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00053918 Copy
http://www.wormbase.org/db/get?name=WBStrain00053850
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37746063
Synonyms: EMPTY
Notes: [2023-08-22T22:52:17.256Z WBPerson712] New Strain: The inbred C. nigoni strain CP168, (further inbred from EG5268) was a gift from Eric Haag and Erich Schwarz. WBPaper00065913. 10.17912/micropub.biology.000968
Proper citation: RRID:WB-STRAIN:WBStrain00053850 Copy
http://www.wormbase.org/db/get?name=WBStrain00054129
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37474586
Synonyms: daf-2(e1370)
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00054129 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
