Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Wfs1em1Ptsn Resource Report Resource Website |
RRID:RGD_149735334 | Rattus norvegicus | Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine). | 149735334 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 149735334 | RGD | 2026-09-19 01:18:52 | 0 | |||||
|
OFA(SD)-Dsg4hr/Crl Resource Report Resource Website |
RRID:RGD_150521602 | Rattus norvegicus | This Iffa Credo ( IC) hairless strain was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. | 150521602 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521602 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
BN.ZUC-Leprfa Resource Report Resource Website |
RRID:RGD_40924656 | Rattus norvegicus | Established as congenics by introducing fa from 13M/Vc to BN/Crl | 40924656 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2021-01-19) | 40924656 | RGD | 2026-09-19 01:18:52 | 0 | |||||
|
LE-ROSA26em1(EF1a-TetR, Fos-iCre)/Bhope Resource Report Resource Website |
RRID:RGD_151356945 | Rattus norvegicus | Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). | 151356945 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 151356945 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
LE-Fxn em2Fara-/+/Rrrc Resource Report Resource Website |
RRID:RGD_152999002 | Rattus norvegicus | Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC Rat Resource and Research Center | 152999002 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152999002 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
LE-Fxn em2Fara-/+ Resource Report Resource Website |
RRID:RGD_152999000 | Rattus norvegicus | Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system This strain has been deposited with RRRC | 152999000 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152999000 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
F344-Nppcem3Kyo Resource Report Resource Website |
RRID:RGD_127284870 | Rattus norvegicus | This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) National BioResource Project for the Rat in Japan | 127284870 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127284870 | RGD | 2026-09-19 01:18:52 | 0 | |||||
|
LEW.SD-CD8am1Trg Resource Report Resource Website |
RRID:RGD_150521559 | Rattus norvegicus | Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60 mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab. | 150521559 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521559 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
F344-Trpc4Tn(sb)1Bni Resource Report Resource Website |
RRID:RGD_126848804 | Rattus norvegicus | The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis | 126848804 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126848804 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
F344-Hcn1em4Kyo Resource Report Resource Website |
RRID:RGD_38676255 | Rattus norvegicus | TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan | 38676255 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-16) | 38676255 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
SD-Tbc1d1Tn(sb)1Fkh Resource Report Resource Website |
RRID:RGD_150521708 | Rattus norvegicus | The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley. | 150521708 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150521708 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
F344-Hcn1em3Kyo Resource Report Resource Website |
RRID:RGD_38676250 | Rattus norvegicus | TALEN (Left:ttcagＡＡＴＧＡＴＴＣＡＴＧＧＧ, Right:ＡＣＧＣＡＣＴＣＴＴＣＡＡＡＧＣＴＡ）targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan | 38676250 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-16) | 38676250 | RGD | 2026-09-19 01:18:52 | 0 | |||||
|
LE-Chrna5em20(D398N)Pas Resource Report Resource Website |
RRID:RGD_14402421 | Rattus norvegicus | The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous. | 14402421 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14402421 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
SD-Mertkem1Cgen Resource Report Resource Website |
RRID:RGD_329322880 | Rattus norvegicus | The gRNA to rat Mertk gene, and Cas9 mRNA were co-injected into fertilized rat eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype rat to test germline transmission and F1 animal generation. This strain was derived from founder 6# carrying a 13934 deletion which included exons 3 to 5. Cyagen Biosciences (Guangzhou) Inc.Building D, 3rd Floor, 3 Juquan Road, Science City, Guangzhou, 510663, China | 329322880 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2023-04-24) | 329322880 | RGD | 2026-09-19 01:18:54 | 0 | |||||
|
SD-Chrna6em2Slot Resource Report Resource Website |
RRID:RGD_155900757 | Rattus norvegicus | Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC. | 155900757 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09) | 155900757 | RGD | 2026-09-19 01:18:53 | 0 | |||||
|
SD-Chrna6em1Slot Resource Report Resource Website |
RRID:RGD_155900755 | Rattus norvegicus | Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. The laboratory has deposited these strains with the RRRC. | 155900755 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09) | 155900755 | RGD | 2026-09-19 01:18:54 | 0 | |||||
|
SD-Akt1em1Soar Resource Report Resource Website |
RRID:RGD_158013766 | Rattus norvegicus | This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. | 158013766 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 158013766 | RGD | 2026-09-19 01:18:54 | 0 | |||||
|
Taiep Resource Report Resource Website |
RRID:RGD_155631259 | Rattus norvegicus | These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats. | 155631259 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631259 | RGD | 2026-09-19 01:18:54 | 0 | |||||
|
SD-Pde3aem1Bdr Resource Report Resource Website |
RRID:RGD_155631293 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). | 155631293 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631293 | RGD | 2026-09-19 01:18:54 | 0 | |||||
|
SD-Pde3aem2Bdr Resource Report Resource Website |
RRID:RGD_155631295 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL). | 155631295 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631295 | RGD | 2026-09-19 01:18:54 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
