Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00008389
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)|WBGene00006826(unc-97)
Genomic Alteration: WBGene00004879(smg-1), WBGene00006826(unc-97)
Availability: available
Source References: PMID:7348600
Synonyms: smg-1(re1) I; unc-97(su110) X.
Alternate IDs: WB-STRAIN:HE110, CGC_HE110
Notes: Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00008389 Copy
http://www.wormbase.org/db/get?name=WBStrain00008334
Source Database: WormBase (WB)
Affected Genes: WBGene00004796(sid-2)
Genomic Alteration: WBGene00004796(sid-2)
Availability: available
Source References: PMID:38547071
Synonyms: ccIs4251 [(pSAK2) Pmyo-3::GFP::LacZ::NLS + (pSAK4) Pmyo-3::mitochondrial GFP + dpy-20(+)] I; qtIs3 [Pmyo-2::GFP dsRNA hairpin] sid-2(qt42) III; mIs11 [Pmyo-2::GFP + Ppes-10::GFP + gut-promoter::GFP] IV
Alternate IDs: WB-STRAIN:HC271, CGC_HC271
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
Proper citation: RRID:WB-STRAIN:WBStrain00008334 Copy
http://www.wormbase.org/db/get?name=WBStrain00008314
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C10C6.7(goe5) IV.
Alternate IDs: WB-STRAIN:HBR764, CGC_HBR764
Notes: goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.|"Made_by: Lewandrowski & Turek"
Proper citation: RRID:WB-STRAIN:WBStrain00008314 Copy
http://www.wormbase.org/db/get?name=WBStrain00008315
Source Database: WormBase (WB)
Affected Genes: WBGene00002988(lim-6)
Genomic Alteration: WBGene00002988(lim-6)
Availability: available
Source References: EMPTY
Synonyms: lim-6(tm4836) X.
Alternate IDs: WB-STRAIN:HBR914, CGC_HBR914
Notes: Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008315 Copy
http://www.wormbase.org/db/get?name=WBStrain00008316
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; goeEx361.
Alternate IDs: WB-STRAIN:HBR986, CGC_HBR986
Notes: goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008316 Copy
http://www.wormbase.org/db/get?name=WBStrain00008319
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: goeIs247.
Alternate IDs: WB-STRAIN:HBR1077, CGC_HBR1077
Notes: goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008319 Copy
http://www.wormbase.org/db/get?name=WBStrain00008320
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: goeIs288.
Alternate IDs: WB-STRAIN:HBR1261, CGC_HBR1261
Notes: goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008320 Copy
http://www.wormbase.org/db/get?name=WBStrain00008321
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: mihp-2(syb235) V.
Alternate IDs: WB-STRAIN:HBR1971, CGC_HBR1971
Notes: Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.|"Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.Primers for crossing: Fwd: cgagacttttaaccccgtcgInFwd: aaagcccatgacttgctgaaRev: gctcaggtggttagagggttWild-type bands: 580bp, 2652bp. Mutation band: 335bp."|"Made_by: SunyBiotech Corperation"
Proper citation: RRID:WB-STRAIN:WBStrain00008321 Copy
http://www.wormbase.org/db/get?name=WBStrain00022765
Source Database: WormBase (WB)
Affected Genes: WBGene00001526(gck-1)
Genomic Alteration: WBGene00001526(gck-1)
Availability: available
Source References: EMPTY
Synonyms: gck-1(km15) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:JS345, CGC_JS345
Notes: Made_by: Katie Schouest|"Maintain by picking GFP+ wild-type worms. Heterozygotes segregate wild-type GFP+ heterozygotes, sterile GFP- gck-1 homozygotes, and dead eggs (nT1 homozygotes). Reference: Schouest et al, Plos ONE 4(10):e7450 (2009)."
Proper citation: RRID:WB-STRAIN:WBStrain00022765 Copy
http://www.wormbase.org/db/get?name=WBStrain00022800
Source Database: WormBase (WB)
Affected Genes: WBGene00003813(nrf-6)
Genomic Alteration: WBGene00003813(nrf-6)
Availability: available
Source References: PMID:10488330
Synonyms: nrf-6(sa525) II.
Alternate IDs: WB-STRAIN:JT525, CGC_JT525
Notes: Nrf, Peg, accumulates yolk in pseudo-coelomic space, slow growing, partial embryonic lethality.
Proper citation: RRID:WB-STRAIN:WBStrain00022800 Copy
http://www.wormbase.org/db/get?name=WBStrain00022760
Source Database: WormBase (WB)
Affected Genes: WBGene00001186(egl-18)
Genomic Alteration: WBGene00001186(egl-18)
Availability: available
Source References: PMID:34506477
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:JR2370, CGC_JR2370
Notes: Made_by:|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00022760 Copy
http://www.wormbase.org/db/get?name=WBStrain00022762
Source Database: WormBase (WB)
Affected Genes: WBGene00000256(bli-6)|WBGene00001079(dpy-20)|WBGene00006759(unc-22)|WBGene00006761(unc-24)|WBGene00009882(vha-17)
Genomic Alteration: WBGene00000256(bli-6), WBGene00001079(dpy-20), WBGene00006759(unc-22), WBGene00006761(unc-24), WBGene00009882(vha-17)
Availability: available
Source References: EMPTY
Synonyms: bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV.
Alternate IDs: WB-STRAIN:JR2750, CGC_JR2750
Notes: Pick wild type animals to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00022762 Copy
http://www.wormbase.org/db/get?name=WBStrain00022764
Source Database: WormBase (WB)
Affected Genes: WBGene00000098(air-1)
Genomic Alteration: WBGene00000098(air-1)
Availability: available
Source References: EMPTY
Synonyms: air-1(vw5) V/eT1 (III;V).
Alternate IDs: WB-STRAIN:JS83, CGC_JS83
Notes: Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00022764 Copy
http://www.wormbase.org/db/get?name=WBStrain00022763
Source Database: WormBase (WB)
Affected Genes: WBGene00000098(air-1)|WBGene00001073(dpy-11)
Genomic Alteration: WBGene00000098(air-1), WBGene00001073(dpy-11)
Availability: available
Source References: EMPTY
Synonyms: dpy-11(e224) air-1(vw5) V/eT1 (III;V).
Alternate IDs: WB-STRAIN:JS71, CGC_JS71
Notes: Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00022763 Copy
http://www.wormbase.org/db/get?name=WBStrain00022755
Source Database: WormBase (WB)
Affected Genes: WBGene00000903(daf-7)|WBGene00001063(dpy-1)|WBGene00003917(par-2)
Genomic Alteration: WBGene00000903(daf-7), WBGene00001063(dpy-1), WBGene00003917(par-2)
Availability: available
Source References: PMID:9136010
Synonyms: wcDf1 dpy-1(e1)/daf-7(e1372) par-2(it46) III.
Alternate IDs: WB-STRAIN:JR1763, CGC_JR1763
Notes: At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00022755 Copy
http://www.wormbase.org/db/get?name=WBStrain00022758
Source Database: WormBase (WB)
Affected Genes: WBGene00001311(end-3)
Genomic Alteration: WBGene00001311(end-3)
Availability: available
Source References: EMPTY
Synonyms: wIs137 V.
Alternate IDs: WB-STRAIN:JR2274, CGC_JR2274
Notes: Made_by: Morros Maduro|"Mutagen:Gamma radiation"|"wIs137 [(pMM446) end-3p::end-3(P202L)::GFP + (pRF4) rol-6(su1006)] V. Rollers. Reference: Maduro MF, et al. Dev Biol. 2005 Aug 15;284(2):509-22."|"wIs137 [end-3p::end-3(P202L)::GFP + rol-6(su1006)] V. Rollers. Reference: Maduro MF, et al. Dev Biol. 2005 Aug 15;284(2):509-22."
Proper citation: RRID:WB-STRAIN:WBStrain00022758 Copy
http://www.wormbase.org/db/get?name=WBStrain00022707
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: vxEx105.
Alternate IDs: WB-STRAIN:JPS48, CGC_JPS48
Notes: vxEx105 [dat-1p::ChR2::mCherry + myo-2p::mCherry]. Raise on retinal for optogenetic manipulations (per Vidal-Gadea, 2011). Not necessary for survival. Reference: Vidal-Gadea A, et al. Proc Natl Acad Sci U S A. 2011 Oct 18;108(42):17504-9.
Proper citation: RRID:WB-STRAIN:WBStrain00022707 Copy
http://www.wormbase.org/db/get?name=WBStrain00022788
Source Database: WormBase (WB)
Affected Genes: WBGene00004740(scd-2)
Genomic Alteration: WBGene00004740(scd-2)
Availability: available
Source References: PMID:37572357
Synonyms: scd-2(sa249) V.
Alternate IDs: WB-STRAIN:JT249, CGC_JT249
Notes: Responds poorly to dauer pheromone.|"Supplementary_genotype scd-2(sa249)"
Proper citation: RRID:WB-STRAIN:WBStrain00022788 Copy
http://www.wormbase.org/db/get?name=WBStrain00022702
Source Database: WormBase (WB)
Affected Genes: WBGene00013261(sinh-1)
Genomic Alteration: WBGene00013261(sinh-1)
Availability: available
Source References: EMPTY
Synonyms: sinh-1(pe420) II.
Alternate IDs: WB-STRAIN:JN2411, CGC_JN2411
Notes: Chemotaxis abnormality, developmental delay, small brood size. pe420 is a 22 bp deletion in exon 1.|"Made_by: Hayao Ohno/Naoko Sakai"
Proper citation: RRID:WB-STRAIN:WBStrain00022702 Copy
http://www.wormbase.org/db/get?name=WBStrain00022703
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: peEx2513.
Alternate IDs: WB-STRAIN:JN2513, CGC_JN2513
Notes: peEx2513 [ceh36p::DownwardDAG2(worm) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.
Proper citation: RRID:WB-STRAIN:WBStrain00022703 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
