Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00037463

Source Database: WormBase (WB)
Affected Genes: WBGene00004457(rpm-1)|WBGene00009109(degt-1)
Genomic Alteration: WBGene00004457(rpm-1), WBGene00009109(degt-1)
Availability: available
Source References: PMID:32009302, PMID:35622515, PMID:37500635
Synonyms: rpm-1(ju1928) degt-1(ok3307) V.
Alternate IDs: WB-STRAIN:VC2633, CGC_VC2633
Notes: F25D1.4. External left primer: TCAAGGAAGCATCCGAAGTT. External right primer: CCACGGATGAATCGAGTTTT. Internal left primer: TCAGATTTTTGGAGTTTCCGA. Internal right primer: TTATTCGATTTTCCCCGTTG. Internal WT amplicon: 1152 bp. Deletion size: 915 bp. Deletion left flank: TTTTGGAGTTTCCGATAATTTCCATGATGT. Deletion right flank: TTCAGTGATAAATTTTCAAATTTCTCGAAA. [NOTE: (05/10/2022) This strain also carries an (A to T) missense mutation in rpm-1 which results in a Q3089H amino acid substitution in RPM-1. See Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037463 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037433

Source Database: WormBase (WB)
Affected Genes: WBGene00001445(flp-2)
Genomic Alteration: WBGene00001445(flp-2)
Availability: available
Synonyms: flp-2(ok3351) X.
Alternate IDs: WB-STRAIN:VC2591, CGC_VC2591
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W07E11.3. External left primer: TCAACTCTCACACAGCCCAC. External right primer: ATTTTCAGGTACACACCCGC. Internal left primer: GTTGGTTGAGATGCCACCTT. Internal right primer: CACAGAGCTTTCGTCTGACTC. Internal WT amplicon: 1219 bp. Deletion size: 372 bp. Deletion left flank: TTCCAAATATGTGTTTGGGTTTTAAGCTTG. Deletion right flank: CGACAATTGGTTTGGCAACGACTGACAATG."

Proper citation: RRID:WB-STRAIN:WBStrain00037433 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037507

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006958(wve-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006958(wve-1)
Availability: available
Source References: PMID:38190406
Synonyms: wve-1(ok3308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2706, CGC_VC2706
Notes: R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037507 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037580

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00009701(egg-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00009701(egg-3)
Availability: available
Synonyms: egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2876, CGC_VC2876
Notes: F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037580 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037610

Source Database: WormBase (WB)
Affected Genes: WBGene00011299(ikke-1)
Genomic Alteration: WBGene00011299(ikke-1)
Availability: available
Synonyms: gkDf24 I; ikke-1(gk1264) III.
Alternate IDs: WB-STRAIN:VC2982, CGC_VC2982
Notes: F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037610 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037698

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00009052(ekl-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00009052(ekl-1)
Availability: available
Synonyms: ekl-1(ok1197) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3150, CGC_VC3150
Notes: F22D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1197 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGTACACATTCATCGTTGC. External right primer: CGGTATGTGTGGATGTCGAG. Internal left primer: GCAATGCTCTTCTCTGTCCC. Internal right primer: GAGATCAATTTGGCCATTCG. Internal WT amplicon: 2672 bp. Deletion size: 1008 bp. Deletion left flank: ATTTTTTAAAGAACTGGAAGAAATGCGAAT. Deletion right flank: TGTGAGTGAATATAACCAAAACACCAATGC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037698 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037611

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)
Genomic Alteration: WBGene00001072(dpy-10)
Availability: available
Synonyms: dpy-10(gk3075) II.
Alternate IDs: WB-STRAIN:VC2985, CGC_VC2985
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

Proper citation: RRID:WB-STRAIN:WBStrain00037611 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037725

Source Database: WormBase (WB)
Affected Genes: WBGene00004237(ptr-23)
Genomic Alteration: WBGene00004237(ptr-23)
Availability: available
Synonyms: ptr-23(ok3663) I.
Alternate IDs: WB-STRAIN:VC3219, CGC_VC3219
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK270.1. Dpy or Dpyish. External left primer: CAACCAGATGACGCAGCTAA. External right primer: TGATTCCATTTCACGGACAA. Internal left primer: CCGGTCTCCAGGATAACAAA. Internal right primer: GTAGCCATGGAATACACGGG. Internal WT amplicon: 1140 bp. Deletion size: 899 bp. Deletion left flank: GGATAACAAATGTAAAGTCAGTCAAAATGA. Deletion right flank: ATATACACATTTGATGACGACACCGCTGGT."

Proper citation: RRID:WB-STRAIN:WBStrain00037725 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037720

Source Database: WormBase (WB)
Affected Genes: WBGene00013878(atfs-1)
Genomic Alteration: WBGene00013878(atfs-1)
Availability: available
Source References: PMID:33542359, PMID:37902464
Synonyms: atfs-1(gk3094) V.
Alternate IDs: WB-STRAIN:VC3201, CGC_VC3201
Notes: Mutagen:UV/TMP|"Supplementary_genotype atfs-1(gk3094)"|"This strain is homozygous for a deletion (gk3094) in ZC376.7, detectable by PCR using the following primers. External left primer: TTTCAGTCGTTTCAGGACCC. External right primer: TCATCGAGTTGATCTCACGC. Internal left primer: ATAGAAACCGCCTCCTTTCG. Internal right primer: TTCTCGGCTCGTTTCTTCTC. Internal WT amplicon: 2877 bp. Deletion size: 881 bp. Deletion left flank: ACTGGACCTCGACTCATGGCACACTAAGCC. Deletion right flank: ATCAAGTTATCTTCACGGAAAAATGTTCGA. Validation: gk3094 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037720 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037706

Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Synonyms: har-1(gk3124) III.
Alternate IDs: WB-STRAIN:VC3169, CGC_VC3169
Notes: C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037706 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037717

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008990(smgl-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008990(smgl-1)
Availability: available
Synonyms: smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3196, CGC_VC3196
Notes: F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037717 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037781

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00011071(R06F6.8)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00011071(R06F6.8)
Availability: available
Synonyms: R06F6.8(ok1318)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC3391, CGC_VC3391
Notes: Mutagen:UV/TMP|"R06F6.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1318 homozygotes (sterile, lays unfertilized oocytes and very few fertilized eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATAAACGTCATTTCCT. External right primer: AACGTTTTTGCGTTCCAAAT. Internal left primer: TTGATTCCTTTTGCACCACA. Internal right primer: CTTCCGAAGCATGAAAAGGA. Internal WT amplicon: 3207 bp. Deletion size: 1673 bp. Deletion left flank: CAACCGACGCATATCGACTGTCAAGTCTCT. Deletion right flank: TTAATTCTCCACGTGTTTCTTTGAAATTGG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037781 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00037912

Source Database: WormBase (WB)
Affected Genes: WBGene00000714(col-141)
Genomic Alteration: WBGene00000714(col-141)
Availability: available
Synonyms: col-141(gk5185) V.
Alternate IDs: WB-STRAIN:VC4094, CGC_VC4094
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037912 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038146

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20204, CGC_VC20204
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038146 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038118

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20176, CGC_VC20176
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038118 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038192

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20251, CGC_VC20251
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038192 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038210

Source Database: WormBase (WB)
Availability: available
Source References: PMID:39378880
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20270, CGC_VC20270
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038210 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038268

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20331, CGC_VC20331
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038268 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00038592

Source Database: WormBase (WB)
Availability: available
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20661, CGC_VC20661
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038592 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00050514

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34195824
Synonyms: (cp52[nmy-2::mkate2 + LoxP unc-119(+) LoxP] I; ccm-3(mon9[ccm-3::mNeonGreen^3xFlag]) II; unc-119(ed3)* III; ltIs44[pAA173,Ppie-1::mCherry::PH(PLC1delta1); unc-119(+)]).
Notes: Generated from papers flagged positive during the last month for data type afp_otherstrain and contains genotype and gene data.

Proper citation: RRID:WB-STRAIN:WBStrain00050514 Copy   

•   Source: WormBase