Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RG1590 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033329 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00033329 | WormBase (WB) | WB | unknown | PMID:38839826 | WB-STRAIN:RG1590 | 2026-08-15 09:32:14 | 0 | ||||
|
RG93 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033321 | Caenorhabditis elegans | lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle). | WBGene00001072(dpy-10)|WBGene00003015(lin-29)|WBGene00004394(rol-1)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00003015(lin-29), WBGene00004394(rol-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00033321 | WormBase (WB) | WB | available | PMID:7671813 | WB-STRAIN:RG93, CGC_RG93 | 2026-08-15 09:32:13 | 0 | ||
|
RG174 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033322 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001953(hlh-8) | WBGene00001953(hlh-8) | WB-STRAIN:WBStrain00033322 | WormBase (WB) | WB | unknown | WB-STRAIN:RG174 | 2026-08-15 09:32:13 | 0 | |||
|
RG365 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033323 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00000608(col-19) | WBGene00000608(col-19) | WB-STRAIN:WBStrain00033323 | WormBase (WB) | WB | unknown | WB-STRAIN:RG365 | 2026-08-15 09:32:14 | 0 | |||
|
RG3007 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033336 | Caenorhabditis elegans | sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-28. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005054(sra-28)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005054(sra-28), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033336 | WormBase (WB) | WB | available | WB-STRAIN:RG3007, CGC_RG3007 | 2026-08-15 09:32:14 | 0 | |||
|
RG3011 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033338 | Caenorhabditis elegans | sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-17. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT"|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005043(sra-17)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005043(sra-17), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033338 | WormBase (WB) | WB | available | PMID:34429473 | WB-STRAIN:RG3011, CGC_RG3011 | 2026-08-15 09:32:14 | 0 | ||
|
RG3012 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033339 | Caenorhabditis elegans | sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-27. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctcttagtattattattatttgttccccct Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005053(sra-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005053(sra-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033339 | WormBase (WB) | WB | available | WB-STRAIN:RG3012, CGC_RG3012 | 2026-08-15 09:32:14 | 0 | |||
|
RG3000 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033330 | Caenorhabditis elegans | sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-34. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: GAATTAATACAAACAACAGGAGCTGGAACA Right flanking sequence: gaaggtattgaataaaacgcggaagttcta" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005060(sra-34)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005060(sra-34), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033330 | WormBase (WB) | WB | available | WB-STRAIN:RG3000, CGC_RG3000 | 2026-08-15 09:32:14 | 0 | |||
|
RG3004 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033334 | Caenorhabditis elegans | sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033334 | WormBase (WB) | WB | available | WB-STRAIN:RG3004, CGC_RG3004 | 2026-08-15 09:32:14 | 0 | |||
|
RG3006 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033335 | Caenorhabditis elegans | sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033335 | WormBase (WB) | WB | available | WB-STRAIN:RG3006, CGC_RG3006 | 2026-08-15 09:32:14 | 0 | |||
|
RP828 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033425 | Caenorhabditis elegans | madd-2(tr103) V. | Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72. | WBGene00016539(madd-2) | WBGene00016539(madd-2) | WB-STRAIN:WBStrain00033425 | WormBase (WB) | WB | available | WB-STRAIN:RP828, CGC_RP828 | 2026-08-15 09:32:16 | 0 | |||
|
RP1416 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033426 | Caenorhabditis elegans | madd-2(tr129) V. | Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72. | WBGene00016539(madd-2) | WBGene00016539(madd-2) | WB-STRAIN:WBStrain00033426 | WormBase (WB) | WB | available | WB-STRAIN:RP1416, CGC_RP1416 | 2026-08-15 09:32:16 | 0 | |||
|
RP2635 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033427 | Caenorhabditis elegans | mev-1(tr355) III. | EMPTY | WBGene00003225(mev-1) | WBGene00003225(mev-1) | WB-STRAIN:WBStrain00033427 | WormBase (WB) | WB | unknown | PMID:26108372 PMID:38719808 |
WB-STRAIN:RP2635 | 2026-08-15 09:32:16 | 0 | ||
|
RP2636 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033428 | Caenorhabditis elegans | sdhb-1(tr356) II. | EMPTY | WBGene00006433(sdhb-1) | WBGene00006433(sdhb-1) | WB-STRAIN:WBStrain00033428 | WormBase (WB) | WB | unknown | PMID:26108372 | WB-STRAIN:RP2636 | 2026-08-15 09:32:16 | 0 | ||
|
RP2637 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033429 | Caenorhabditis elegans | mev-1(tr357) III. | EMPTY | WBGene00003225(mev-1) | WBGene00003225(mev-1) | WB-STRAIN:WBStrain00033429 | WormBase (WB) | WB | available | PMID:26108372 | WB-STRAIN:RP2637, CGC_RP2637 | 2026-08-15 09:32:16 | 0 | ||
|
RP582 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033420 | Caenorhabditis elegans | egl-19(tr69) IV. | Made_by: T Kwok/P Roy|"Nemadipine-A resistant." | WBGene00001187(egl-19) | WBGene00001187(egl-19) | WB-STRAIN:WBStrain00033420 | WormBase (WB) | WB | available | WB-STRAIN:RP582, CGC_RP582 | 2026-08-15 09:32:15 | 0 | |||
|
RP584 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033422 | Caenorhabditis elegans | egl-19(tr71) IV. | Made_by: Kwok/Turnbull/P Roy|"Nemadipine-A resistant." | WBGene00001187(egl-19) | WBGene00001187(egl-19) | WB-STRAIN:WBStrain00033422 | WormBase (WB) | WB | available | WB-STRAIN:RP584, CGC_RP584 | 2026-08-15 09:32:16 | 0 | |||
|
RP585 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033423 | Caenorhabditis elegans | egl-19(tr72) IV. | Made_by: T Kwok/P Roy|"Myotonic. Nemadipine-A resistant." | WBGene00001187(egl-19) | WBGene00001187(egl-19) | WB-STRAIN:WBStrain00033423 | WormBase (WB) | WB | available | WB-STRAIN:RP585, CGC_RP585 | 2026-08-15 09:32:15 | 0 | |||
|
RP2672 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033437 | Caenorhabditis elegans | sdhd-1(tr391) II. | EMPTY | WBGene00009353(sdhd-1) | WBGene00009353(sdhd-1) | WB-STRAIN:WBStrain00033437 | WormBase (WB) | WB | unknown | PMID:26108372 | WB-STRAIN:RP2672 | 2026-08-15 09:32:16 | 0 | ||
|
RP2673 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033438 | Caenorhabditis elegans | mev-1(tr392) III. | EMPTY | WBGene00003225(mev-1) | WBGene00003225(mev-1) | WB-STRAIN:WBStrain00033438 | WormBase (WB) | WB | unknown | PMID:26108372 | WB-STRAIN:RP2673 | 2026-08-15 09:32:16 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.