Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00006407
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003134(mat-3)
Genomic Alteration: WBGene00001867(him-8), WBGene00003134(mat-3)
Availability: available
Synonyms: mat-3(or180) III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DS73, CGC_DS73
Notes: Temperature sensitive. Maintain at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00006407 Copy
http://www.wormbase.org/db/get?name=WBStrain00006402
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00003050(liv-4)|WBGene00004510(rrf-3)
Genomic Alteration: WBGene00000912(daf-16), WBGene00003050(liv-4), WBGene00004510(rrf-3)
Availability: available
Synonyms: daf-16(m26) I; rrf-3(b26) II; liv-4(m872) V.
Alternate IDs: WB-STRAIN:DR2208, CGC_DR2208
Notes: daf-d on starvation. Sterile at 25C. Maintain at 15C. Mild Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00006402 Copy
http://www.wormbase.org/db/get?name=WBStrain00006412
Source Database: WormBase (WB)
Affected Genes: WBGene00003133(apc-1)
Genomic Alteration: WBGene00003133(apc-1)
Availability: available
Synonyms: apc-1(ax102) II.
Alternate IDs: WB-STRAIN:DS98, CGC_DS98
Notes: Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2."
Proper citation: RRID:WB-STRAIN:WBStrain00006412 Copy
http://www.wormbase.org/db/get?name=WBStrain00006411
Source Database: WormBase (WB)
Affected Genes: WBGene00003133(apc-1)
Genomic Alteration: WBGene00003133(apc-1)
Availability: available
Synonyms: apc-1(ax76) II.
Alternate IDs: WB-STRAIN:DS97, CGC_DS97
Notes: Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2."
Proper citation: RRID:WB-STRAIN:WBStrain00006411 Copy
http://www.wormbase.org/db/get?name=WBStrain00006680
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Synonyms: nas-37(tm410) X.
Alternate IDs: WB-STRAIN:EG3283, CGC_EG3283
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00006680 Copy
http://www.wormbase.org/db/get?name=WBStrain00006678
Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.
Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy
http://www.wormbase.org/db/get?name=WBStrain00006675
Source Database: WormBase (WB)
Availability: available
Synonyms: oxEx344.
Alternate IDs: WB-STRAIN:EG2537, CGC_EG2537
Notes: oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00006675 Copy
http://www.wormbase.org/db/get?name=WBStrain00006691
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:37221008, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4349, CGC_EG4349
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
Proper citation: RRID:WB-STRAIN:WBStrain00006691 Copy
http://www.wormbase.org/db/get?name=WBStrain00006689
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:37865119, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4347, CGC_EG4347
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
Proper citation: RRID:WB-STRAIN:WBStrain00006689 Copy
http://www.wormbase.org/db/get?name=WBStrain00006618
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3011, CGC_ED3011
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006618 Copy
http://www.wormbase.org/db/get?name=WBStrain00006617
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3010, CGC_ED3010
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006617 Copy
http://www.wormbase.org/db/get?name=WBStrain00006616
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3005, CGC_ED3005
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.
Proper citation: RRID:WB-STRAIN:WBStrain00006616 Copy
http://www.wormbase.org/db/get?name=WBStrain00006699
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Synonyms: lin-15B&lin-15A(n765) X; oxEx1088.
Alternate IDs: WB-STRAIN:EG4813, CGC_EG4813
Notes: oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.
Proper citation: RRID:WB-STRAIN:WBStrain00006699 Copy
http://www.wormbase.org/db/get?name=WBStrain00006698
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33593818, PMID:33820969, PMID:38564369, PMID:39303031, PMID:39853894
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4725, CGC_EG4725
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006698 Copy
http://www.wormbase.org/db/get?name=WBStrain00006630
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3041, CGC_ED3041
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta."|"Made_by: A Cutter & E Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006630 Copy
http://www.wormbase.org/db/get?name=WBStrain00006627
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3024, CGC_ED3024
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006627 Copy
http://www.wormbase.org/db/get?name=WBStrain00006622
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3017, CGC_ED3017
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006622 Copy
http://www.wormbase.org/db/get?name=WBStrain00006641
Source Database: WormBase (WB)
Availability: available
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3053, CGC_ED3053
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006641 Copy
http://www.wormbase.org/db/get?name=WBStrain00006640
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:37008729, PMID:37572357, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3052, CGC_ED3052
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00006640 Copy
http://www.wormbase.org/db/get?name=WBStrain00006637
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:32857789, PMID:33820969, PMID:37008729, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3049, CGC_ED3049
Notes: Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."
Proper citation: RRID:WB-STRAIN:WBStrain00006637 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
