Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DS73 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006407 | Caenorhabditis elegans | mat-3(or180) III; him-8(e1489) IV. | Temperature sensitive. Maintain at 15C. | WBGene00001867(him-8)|WBGene00003134(mat-3) | WBGene00001867(him-8), WBGene00003134(mat-3) | WB-STRAIN:WBStrain00006407 | WormBase (WB) | WB | available | WB-STRAIN:DS73, CGC_DS73 | WormBase | 2026-09-26 11:22:01 | 0 | |||
|
DR2208 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006402 | Caenorhabditis elegans | daf-16(m26) I; rrf-3(b26) II; liv-4(m872) V. | daf-d on starvation. Sterile at 25C. Maintain at 15C. Mild Unc. | WBGene00000912(daf-16)|WBGene00003050(liv-4)|WBGene00004510(rrf-3) | WBGene00000912(daf-16), WBGene00003050(liv-4), WBGene00004510(rrf-3) | WB-STRAIN:WBStrain00006402 | WormBase (WB) | WB | available | WB-STRAIN:DR2208, CGC_DR2208 | WormBase | 2026-09-26 11:22:01 | 0 | |||
|
DS98 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006412 | Caenorhabditis elegans | apc-1(ax102) II. | Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2." | WBGene00003133(apc-1) | WBGene00003133(apc-1) | WB-STRAIN:WBStrain00006412 | WormBase (WB) | WB | available | WB-STRAIN:DS98, CGC_DS98 | WormBase | 2026-09-26 11:22:01 | 1 | |||
|
DS97 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006411 | Caenorhabditis elegans | apc-1(ax76) II. | Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2." | WBGene00003133(apc-1) | WBGene00003133(apc-1) | WB-STRAIN:WBStrain00006411 | WormBase (WB) | WB | available | WB-STRAIN:DS97, CGC_DS97 | WormBase | 2026-09-26 11:22:01 | 0 | |||
|
EG3283 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006680 | Caenorhabditis elegans | nas-37(tm410) X. | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.|"Mutagen:UV/TMP" | WBGene00003553(nas-37) | WBGene00003553(nas-37) | WB-STRAIN:WBStrain00006680 | WormBase (WB) | WB | available | WB-STRAIN:EG3283, CGC_EG3283 | WormBase | 2026-09-26 11:22:05 | 0 | |||
|
EG3027 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006678 | Caenorhabditis elegans | unc-26(s1710) IV. | Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping. | WBGene00006763(unc-26) | WBGene00006763(unc-26) | WB-STRAIN:WBStrain00006678 | WormBase (WB) | WB | available | PMID:35065714 PMID:37053235 |
WB-STRAIN:EG3027, CGC_EG3027 | WormBase | 2026-09-26 11:22:05 | 1 | ||
|
EG2537 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006675 | Caenorhabditis elegans | oxEx344. | oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C. | WB-STRAIN:WBStrain00006675 | WormBase (WB) | WB | available | WB-STRAIN:EG2537, CGC_EG2537 | WormBase | 2026-09-26 11:22:05 | 0 | |||||
|
EG4349 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006691 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. | WB-STRAIN:WBStrain00006691 | WormBase (WB) | WB | available | PMID:33820969 PMID:37221008 PMID:38564369 |
WB-STRAIN:EG4349, CGC_EG4349 | WormBase | 2026-09-26 11:22:05 | 0 | ||||
|
EG4347 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006689 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. | WB-STRAIN:WBStrain00006689 | WormBase (WB) | WB | available | PMID:33820969 PMID:37865119 PMID:38564369 |
WB-STRAIN:EG4347, CGC_EG4347 | WormBase | 2026-09-26 11:22:05 | 0 | ||||
|
ED3011 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006618 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006618 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3011, CGC_ED3011 | WormBase | 2026-09-26 11:22:04 | 1 | ||||
|
ED3010 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006617 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006617 | WormBase (WB) | WB | available | WB-STRAIN:ED3010, CGC_ED3010 | WormBase | 2026-09-26 11:22:04 | 0 | |||||
|
ED3005 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006616 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. | WB-STRAIN:WBStrain00006616 | WormBase (WB) | WB | available | PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3005, CGC_ED3005 | WormBase | 2026-09-26 11:22:04 | 0 | ||||
|
EG4813 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006699 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; oxEx1088. | oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type. | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00006699 | WormBase (WB) | WB | available | WB-STRAIN:EG4813, CGC_EG4813 | WormBase | 2026-09-26 11:22:05 | 0 | |||
|
EG4725 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006698 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00006698 | WormBase (WB) | WB | available | PMID:22301316 PMID:33593818 PMID:33820969 PMID:38564369 PMID:39303031 PMID:39853894 |
WB-STRAIN:EG4725, CGC_EG4725 | WormBase | 2026-09-26 11:22:05 | 2 | ||||
|
ED3041 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006630 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta."|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006630 | WormBase (WB) | WB | available | WB-STRAIN:ED3041, CGC_ED3041 | WormBase | 2026-09-26 11:22:04 | 0 | |||||
|
ED3024 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006627 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006627 | WormBase (WB) | WB | available | WB-STRAIN:ED3024, CGC_ED3024 | WormBase | 2026-09-26 11:22:04 | 0 | |||||
|
ED3017 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006622 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006622 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3017, CGC_ED3017 | WormBase | 2026-09-26 11:22:04 | 1 | ||||
|
ED3053 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006641 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006641 | WormBase (WB) | WB | available | WB-STRAIN:ED3053, CGC_ED3053 | WormBase | 2026-09-26 11:22:05 | 0 | |||||
|
ED3052 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006640 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype" | WB-STRAIN:WBStrain00006640 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:37008729 PMID:37572357 PMID:38564369 |
WB-STRAIN:ED3052, CGC_ED3052 | WormBase | 2026-09-26 11:22:05 | 1 | ||||
|
ED3049 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006637 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." | WB-STRAIN:WBStrain00006637 | WormBase (WB) | WB | available | PMID:22301316 PMID:32857789 PMID:33820969 PMID:37008729 PMID:38564369 |
WB-STRAIN:ED3049, CGC_ED3049 | WormBase | 2026-09-26 11:22:05 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
