Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=125097491
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo (as of 2021-04-01)
Alternate IDs: 125097491
Notes: Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats.
Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN
Proper citation: RRID:RGD_125097491 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=125097492
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo (as of 2021-04-01)
Alternate IDs: 125097492
Notes: Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN.
Proper citation: RRID:RGD_125097492 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599189
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2020-09-14)
Alternate IDs: 38599189
Notes: This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38599189 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=125097494
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo (as of 2021-04-01)
Alternate IDs: 125097494
Notes: Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, JAPAN
Proper citation: RRID:RGD_125097494 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=125097497
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo (as of 2021-04-01)
Alternate IDs: 125097497
Notes: This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats.
Proper citation: RRID:RGD_125097497 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41410881
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41410881
Notes: This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional.
Proper citation: RRID:RGD_41410881 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128163
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-23)
Alternate IDs: 39128163
Notes: By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 2 bp insertion on Exon1. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_39128163 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=18182944
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2020-01-14)
Alternate IDs: 18182944
Notes: CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_18182944 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394486
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14394486
Notes: The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)
Proper citation: RRID:RGD_14394486 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925978
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925978
Notes: The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA). A silent mutation (ACC to ACG) was also introduced to prevent the binding and re-cutting of the sequence by gRNA after HDR. Founder animals harboring the expected single-nucleotide substitution were bred to produce heterozygous and homozygous rats.The heterozygous rats had phenotypes similar to the wild type littermates.
Proper citation: RRID:RGD_126925978 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394515
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-02-20)
Alternate IDs: 14394515
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. Autism Rat Model Resource, Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_14394515 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174224
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-07-29)
Alternate IDs: 36174224
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol -/- (RGD:36174224) is homozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of both rat Hamp alleles. Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174224 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174226
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-07-29)
Alternate IDs: 36174226
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol -/- (RGD:36174226) is homozygous carrying a 15-bp deletion in exon 2 of both rat Hamp alleles Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174226 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127284883
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127284883
Notes: The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate Aqp4-deficient rats. The synthesized TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. The founder animal lacking three base pairs was crossed with wild-type rat to produced the F1 generration and the heterozygous offspring of F1 were corssed to produce mutant strains and confirmed by sequencing analysis of PCR products of modified genome region.
Proper citation: RRID:RGD_127284883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174220
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-07-29)
Alternate IDs: 36174220
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol -/- (RGD:36174220) is homozygous carrying the 169-bp deletion between exons 2 & 3 of both rat Hamp alleles. Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174220 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174221
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-07-29)
Alternate IDs: 36174221
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol +/- (RGD:36174221) is heterozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174221 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=15090817
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 15090817
Notes: Heterozygous rats carrying a defective exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI.
Proper citation: RRID:RGD_15090817 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128242
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-10-09)
Alternate IDs: 39128242
Notes: CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_39128242 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=15017093
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 15017093
Notes: The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L).
Proper citation: RRID:RGD_15017093 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25330087
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 25330087
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Cntnap2 into Crl:LE embryos. The result is a 1-bp deletion in exon 6 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25330087 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.