Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
+/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049441 | Caenorhabditis elegans | +/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. | Made_by: RG KO Group|"umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003056(lon-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003056(lon-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049441 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:14 | 0 | ||||
|
ZK809.3(ve700[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049439 | Caenorhabditis elegans | ZK809.3(ve700[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049439 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:03 | 0 | ||||
|
+/nT1[umnIs49] IV; rft-1(ve733[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049470 | Caenorhabditis elegans | +/nT1[umnIs49] IV; rft-1(ve733[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 3806 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve733 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaggaataaaatgaacaaggTCACCGACA ; Right flanking sequence: TCGGGAAGTTTCGCTGTCAAAAGTGACAAT. sgRNA #3: ACCGACATGATGGTGCAGAG; sgRNA #2: CTGGGTAAGTTCCATCCTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00044637(rft-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00044637(rft-1) | WB-STRAIN:WBStrain00049470 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:03 | 0 | ||||
|
Y40B1A.1(ve736[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049473 | Caenorhabditis elegans | Y40B1A.1(ve736[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 2839 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gagcctcgaaaactccccaaaaactatacc ; Right flanking sequence: tttcgtgtatttttccgtttgtgtgcaaaa. sgRNA #3: cgtcttgtagatcagctcgg; sgRNA #4: agagatcatcactggaatgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049473 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:03 | 0 | ||||
|
hum-4(ve729[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049466 | Caenorhabditis elegans | hum-4(ve729[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 12032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCATTTTCAACAACTGACTTTAGTCGA ; Right flanking sequence: TTCCAGCTTCGGATTGATCTCTGTAATCAC. sgRNA #6: TAGTGCAGAACACCGAACGT; sgRNA #30: TAGCTCAAAATCTTCACGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00002037(hum-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002037(hum-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049466 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:03 | 0 | ||||
|
txdc-17(ve728[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049465 | Caenorhabditis elegans | txdc-17(ve728[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1195 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTCTGACAACCGGAGAGTCTTGGTGCCC ; Right flanking sequence: TCCAACACTCAAATTGACATGTATTCCGAC. sgRNA #1: TCGTACCAACAACACAATCC; sgRNA #2: TCAGTACGGAATCCGACAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022188(txdc-17) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022188(txdc-17) | WB-STRAIN:WBStrain00049465 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:14 | 0 | ||||
|
hum-8(ve731[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049468 | Caenorhabditis elegans | hum-8(ve731[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 11054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCGATATTTCTGCTCCTCTTTTACCG ; Right flanking sequence: TGGAATTGTTTTCGGCTCAAATGTCCCAAT. sgRNA #51: CTACAGGAGACGCTTCTTGT; sgRNA #6: TTAGGATCCACAATGTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00002041(hum-8)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002041(hum-8), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049468 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:14 | 0 | ||||
|
hum-6(ve730[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049467 | Caenorhabditis elegans | hum-6(ve730[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 10872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTATATTTTCTCAGGGTGACTTCATCTG ; Right flanking sequence: ttttGCAGAGTGTCAGGCGCGTGAATTAGG. sgRNA #11: aaaaGATAAACTCACGACAG; sgRNA #21: GATTGAGCCCGGAAAAACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00002039(hum-6)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002039(hum-6), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049467 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:03 | 0 | ||||
|
unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049003 | Caenorhabditis elegans | unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. | Generated from afp_otherstrain Paper data WBPaper000612001.|"krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https:"|"Made_by: Marissa Glover" | WBGene00003514(myo-2)|WBGene00003515(myo-3)|WBGene00006745(unc-5)|WBGene00006843(unc-119) | WBGene00003514(myo-2), WBGene00003515(myo-3), WBGene00006745(unc-5), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00049003 | WormBase (WB) | WB | unknown | PMID:33740427 PMID:39115289 |
2026-08-29 09:27:04 | 0 | |||
|
dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049332 | Caenorhabditis elegans | dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020910(dgtr-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020910(dgtr-1) | WB-STRAIN:WBStrain00049332 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049324 | Caenorhabditis elegans | Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Made_by: Emily Lorenz-Mueller|"unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049324 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:11 | 0 | ||||
|
sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049326 | Caenorhabditis elegans | sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005044(sra-18)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005044(sra-18), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049326 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
cope-1(ve582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049328 | Caenorhabditis elegans | cope-1(ve582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaagtccgcaatattacattgcgcgtgaag ; Right flanking sequence: CATGGGTTATCGATTTCAATGAGAAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009732(cope-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009732(cope-1) | WB-STRAIN:WBStrain00049328 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
+/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049336 | Caenorhabditis elegans | +/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049336 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:11 | 0 | ||||
|
hoe-1(ve592[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049335 | Caenorhabditis elegans | hoe-1(ve592[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+.Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049335 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049340 | Caenorhabditis elegans | F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tggcacgtcaccaacaaccaccaaccggct ; Right flanking sequence: ttgtactcttccttccaaacttcgtgttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049340 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
+/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049342 | Caenorhabditis elegans | +/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000041(aco-2)|WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000041(aco-2), WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049342 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:12 | 0 | ||||
|
pgm-3(ve599[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049338 | Caenorhabditis elegans | pgm-3(ve599[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | F21D5.1. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 2044 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate adults (ve599 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatttttttcagaaATGGATCTCACTGTT ; Right flanking sequence: cataatctcccaaagttttttttaaatttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009006(pgm-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009006(pgm-3) | WB-STRAIN:WBStrain00049338 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:01 | 0 | ||||
|
icmt-1(ve600[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049339 | Caenorhabditis elegans | icmt-1(ve600[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gattattataaaaagcgtgaaaacgtgaaa ; Right flanking sequence: tggaaaaacaaatagttacgcattatttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017673(icmt-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017673(icmt-1) | WB-STRAIN:WBStrain00049339 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:12 | 0 | ||||
|
vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049394 | Caenorhabditis elegans | vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00012903(vps-2) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00012903(vps-2) | WB-STRAIN:WBStrain00049394 | WormBase (WB) | WB | unknown | 2026-08-29 09:27:02 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
