Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314375
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-03-28)
Alternate IDs: 2314375
Notes: AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314375 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314376
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo (as of 2021-10-05)
Alternate IDs: 2314376
Notes: A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314376 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314378
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2016-10-31)
Alternate IDs: 2314378
Notes: Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314378 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314379
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals
Alternate IDs: 2314379
Notes: A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314379 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314381
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314381
Notes: A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314381 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2306041
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2306041
Notes: Established by ENU mutagenesis. A point mutation in Scn1a gene. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2306041 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2306078
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-09-24)
Alternate IDs: 2306078
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2306078 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314904
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 2314904
Notes: This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. Comparative Medicine, Yale University, Connecticut
Proper citation: RRID:RGD_2314904 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314163
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-05-04)
Alternate IDs: 2314163
Notes: This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314163 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314164
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314164
Notes: A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314164 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314166
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314166
Notes: A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314166 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2304242
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-04-05)
Alternate IDs: 2304242
Notes: Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrnzi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1dfk/Kyo rat is a mutant for circling behavior. although the Atrnzi allele of WTC.ZI-Atrnzi congenic rats was eliminated, the circling behavior remained. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2304242 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314341
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2016-10-24)
Alternate IDs: 2314341
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene.
Proper citation: RRID:RGD_2314341 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314342
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 2314342
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene.
Proper citation: RRID:RGD_2314342 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2313464
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 2313464
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene.
Proper citation: RRID:RGD_2313464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2317278
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 2317278
Notes: These mutants were found in Sprague-Dawley rats at University of Puebla in 1989
Proper citation: RRID:RGD_2317278 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2311693
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 2311693
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene.
Proper citation: RRID:RGD_2311693 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4140469
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 4140469
Notes: from NBRP National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_4140469 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=2314244
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 2314244
Notes: In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_2314244 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 4139879
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Proper citation: RRID:RGD_4139879 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.