Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151356959
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 151356959
Notes: The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell
embryos (C076 line). A rat with an 8-bp deletion upstream of the TTT site
(c.1514_1521delATATCATC) was used to establish the KO strain.
Proper citation: RRID:RGD_151356959 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127284868
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127284868
Notes: This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem2Kyo strain ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194,
NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_127284868 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151667414
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 151667414
Notes: This model expresses cre-recombinase under the control of the endogenous Ckm (creatine kinase, M-type) promoter. Cre was targeted to the rat Ckm gene of LE embryos through CRISP/Cas9 system genome editing system. This strain will be deposited with RRRC
Rat Resource and Research Center
Proper citation: RRID:RGD_151667414 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599155
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38599155
Notes: This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption.
Proper citation: RRID:RGD_38599155 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=45073133
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 45073133
Notes: CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-
Dawley embryos. The destruction of Pon1 gene caused the absence of the the expression of Pon1 mRNA, protein in liver, spleen and thymus in the Pon1 homozygous knock-out rat.
Proper citation: RRID:RGD_45073133 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126848737
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126848737
Notes: The Msh6 knockout mutant rat line was generated by target-selected ENU-driven mutagenesis on Crl:WI rats. The founder rat carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene was bred to obtain homozygous animals.
Proper citation: RRID:RGD_126848737 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150340629
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150340629
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed to produce homozygous wild type and heterozygous mutant littermates.
Proper citation: RRID:RGD_150340629 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151664748
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 151664748
Notes: CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon.
Proper citation: RRID:RGD_151664748 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126777684
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126777684
Notes: The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene.
Proper citation: RRID:RGD_126777684 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126790464
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126790464
Notes: The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted
into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome.
Proper citation: RRID:RGD_126790464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521599
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150521599
Notes: CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478).
Proper citation: RRID:RGD_150521599 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150573818
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150573818
Notes: A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein.
Proper citation: RRID:RGD_150573818 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127345123
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127345123
Notes: This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_127345123 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127345124
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127345124
Notes: This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_127345124 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429815
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429815
Notes: The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids .
Proper citation: RRID:RGD_150429815 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676463
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18)
Alternate IDs: 38676463
Notes: HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. National BioResource Project for the Rat in Japan
;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine
Proper citation: RRID:RGD_38676463 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676464
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-18)
Alternate IDs: 38676464
Notes: By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150523757
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150523757
Notes: Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus
Proper citation: RRID:RGD_150523757 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=27095885
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 27095885
Notes: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_27095885 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735334
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 149735334
Notes: Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine).
Proper citation: RRID:RGD_149735334 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
