SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 66 showing 1301 ~ 1320 out of 1,458 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429618

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429618
Notes: ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used

Proper citation: RRID:RGD_150429618 Copy   


  • RRID:RGD_39457945

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39457945

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 39457945
Notes: The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2.

Proper citation: RRID:RGD_39457945 Copy   


  • RRID:RGD_127285661

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127285661

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127285661
Notes: The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp.

Proper citation: RRID:RGD_127285661 Copy   


  • RRID:RGD_38599146

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599146

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38599146
Notes: The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon.

Proper citation: RRID:RGD_38599146 Copy   


  • RRID:RGD_14398479

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398479

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-05-29)
Alternate IDs: 14398479
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. There was no Xdh protein detected in the kidney cortex tissue of 6-week old homozygous mutants. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14398479 Copy   


  • RRID:RGD_25394528

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394528

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 25394528
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_25394528 Copy   


  • RRID:RGD_38548915

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38548915

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38548915
Notes: The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out.

Proper citation: RRID:RGD_38548915 Copy   


  • RRID:RGD_25330093

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25330093

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 25330093
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_25330093 Copy   


  • RRID:RGD_149735898

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735898

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 149735898
Notes: This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.

Proper citation: RRID:RGD_149735898 Copy   


  • RRID:RGD_14398481

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398481

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 14398481
Notes: CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14398481 Copy   


  • RRID:RGD_14394491

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394491

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2026-02-19)
Alternate IDs: 14394491
Notes: CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14394491 Copy   


  • RRID:RGD_25394530

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394530

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-02-20)
Alternate IDs: 25394530
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). Autism Rat Model Resource. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_25394530 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14696722

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14696722
Notes: This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background.

Proper citation: RRID:RGD_14696722 Copy   


  • RRID:RGD_38676448

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676448

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2020-09-17)
Alternate IDs: 38676448
Notes: This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676448 Copy   


  • RRID:RGD_126925138

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925138

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925138
Notes: This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd.

Proper citation: RRID:RGD_126925138 Copy   


  • RRID:RGD_40818253

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=40818253

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 40818253
Notes: The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3 Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_40818253 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41408337

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41408337
Notes: Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient congenic DA strain is maintained via brother=sister mating

Proper citation: RRID:RGD_41408337 Copy   


  • RRID:RGD_38676451

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676451

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-17)
Alternate IDs: 38676451
Notes: This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676451 Copy   


  • RRID:RGD_14398465

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398465

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2019-04-19)
Alternate IDs: 14398465
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14398465 Copy   


  • RRID:RGD_126925949

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925949

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925949
Notes: The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.

Proper citation: RRID:RGD_126925949 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X