Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-Eif2ak4em1
 
Resource Report
Resource Website
RRID:RGD_38549372 Rattus norvegicus The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. 38549372 mutant Rat Genome Database (RGD) RGD Unknown 38549372 2026-09-12 01:25:37 0
W.F344-Lepm1Kyo
 
Resource Report
Resource Website
RRID:RGD_38599197 Rattus norvegicus This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672). National BioResource Project for the Rat in Japan 38599197 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2020-09-14) 38599197 2026-09-12 01:25:37 0
SD-Nr3c1em1Jhrmn
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_125097486 Rattus norvegicus CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) Strain deposited with the RRRC 125097486 mutant Rat Genome Database (RGD) RGD Unknown 125097486 2026-09-12 01:25:37 1
LEW-Glp1rem2Mcwi
 
Resource Report
Resource Website
RRID:RGD_14394488 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] 14394488 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2026-02-19) 14394488 2026-09-12 01:25:37 0
F344-Nppcem4Kyo
 
Resource Report
Resource Website
RRID:RGD_127284872 Rattus norvegicus This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem4Kyo strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats. National BioResource Project for the Rat in Japan 127284872 mutant Rat Genome Database (RGD) RGD Unknown 127284872 2026-09-12 01:25:37 0
SD-Apoeem1Dlli
 
Resource Report
Resource Website
RRID:RGD_150520186 Rattus norvegicus carried a 130 bp deletion from No.80613571bp to 80613700bp in Apoe gene (NC_005100.4), resulting in a termination codon TAA, and deletion of 231 amino acids of ApoE. 150520186 mutant Rat Genome Database (RGD) RGD Unknown 150520186 2026-09-12 01:25:37 0
LE-Apoeem1DlliLdlrem1Ldlr
 
Resource Report
Resource Website
RRID:RGD_150520187 Rattus norvegicus This Apoe/Ldlr double knock-out (DKO) was derived from cross-breeding of SD-Apoeem1Dlli (RGD:150520186) and SD-Ldlrem1Dlli (150520185). 150520187 mutant Rat Genome Database (RGD) RGD Unknown 150520187 2026-09-12 01:25:37 0
SD-Ccdc39em1Jgn
 
Resource Report
Resource Website
RRID:RGD_150520220 Rattus norvegicus The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. 150520220 mutant Rat Genome Database (RGD) RGD Unknown 150520220 2026-09-12 01:25:37 0
SD-Defb23em1Mlit
 
Resource Report
Resource Website
RRID:RGD_38549353 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. 38549353 mutant Rat Genome Database (RGD) RGD Unknown 38549353 2026-09-12 01:25:37 0
SD-Defb26em1Mlit
 
Resource Report
Resource Website
RRID:RGD_38549354 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. 38549354 mutant Rat Genome Database (RGD) RGD Unknown 38549354 2026-09-12 01:25:37 0
SD-Ngly1em1Ta-/-
 
Resource Report
Resource Website
RRID:RGD_39457950 Rattus norvegicus The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats. Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats. Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile." National BioResource Project for the Rat in Japan 39457950 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-07-22) 39457950 2026-09-12 01:25:37 0
SD-Defb42em1Mlit
 
Resource Report
Resource Website
RRID:RGD_38549355 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. 38549355 mutant Rat Genome Database (RGD) RGD Unknown 38549355 2026-09-12 01:25:37 0
BN-Lx/CubMcwi
 
Resource Report
Resource Website
RRID:RGD_38676495 Rattus norvegicus These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. RGD HRDP, contact Hybrid Rat Diversity Program at [email protected] 38676495 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Embryo (as of 2024-08-06) 38676495 2026-09-12 01:25:37 0
FHH-Chr 1BN-Add3em2Mcwi /Roman
 
Resource Report
Resource Website
RRID:RGD_150429618 Rattus norvegicus ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used 150429618 mutant Rat Genome Database (RGD) RGD Unknown 150429618 2026-09-12 01:25:36 0
WI- Lpar1m1Hubr
 
Resource Report
Resource Website
RRID:RGD_39457945 Rattus norvegicus The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2. 39457945 mutant Rat Genome Database (RGD) RGD Unknown 39457945 2026-09-12 01:25:37 0
SD-Adgrl3em1Huyc
 
Resource Report
Resource Website
RRID:RGD_127285661 Rattus norvegicus The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. 127285661 mutant Rat Genome Database (RGD) RGD Unknown 127285661 2026-09-12 01:25:38 0
BN-Aireem1Ang-/-
 
Resource Report
Resource Website
RRID:RGD_38599146 Rattus norvegicus The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 38599146 mutant Rat Genome Database (RGD) RGD Unknown 38599146 2026-09-12 01:25:37 0
SS-Xdhem1Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_14398479 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. There was no Xdh protein detected in the kidney cortex tissue of 6-week old homozygous mutants. Contact MCW rat distribution at [email protected] 14398479 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2024-05-29) 14398479 2026-09-12 01:25:38 0
SD-Ephx2em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_25394528 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. Contact MCW rat distribution at [email protected] 25394528 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 25394528 2026-09-12 01:25:37 0
SD-Il2rgem1-/y/Mlit
 
Resource Report
Resource Website
RRID:RGD_38548915 Rattus norvegicus The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out. 38548915 mutant Rat Genome Database (RGD) RGD Unknown 38548915 2026-09-12 01:25:38 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.