Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC148 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035544 | Caenorhabditis elegans | zhit-3 tftc-3(gk144)/mIs10 V. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain." | WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006489(zhit-3)|WBGene00014114(tftc-3)|WBGene00017698(F22B7.9) | WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006489(zhit-3), WBGene00014114(tftc-3), WBGene00017698(F22B7.9) | WB-STRAIN:WBStrain00035544 | WormBase (WB) | WB | available | WB-STRAIN:VC148, CGC_VC148 | 2026-08-29 09:22:42 | 0 | |||
|
VC129 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035526 | Caenorhabditis elegans | F33H2.5(gk49)/mIs13 I. | F33H2.5. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (WT homozygotes), and GFP- sterile Uncs with a vulval blip. Pick dim GFP+ WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00009368(pole-1) | WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00009368(pole-1) | WB-STRAIN:WBStrain00035526 | WormBase (WB) | WB | available | WB-STRAIN:VC129, CGC_VC129 | 2026-08-29 09:22:41 | 0 | |||
|
VC404 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035744 | Caenorhabditis elegans | npp-4(ok617)/mIs13 I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54E5A.4. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim pharyngeal GFP signal, and segregate dim GFP, brighter GFP (mIs13 homozygotes) and GFP- ok617 homozygotes (slow-growing, mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain." | WBGene00003514(myo-2)|WBGene00003790(npp-4)|WBGene00003983(pes-10) | WBGene00003514(myo-2), WBGene00003790(npp-4), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00035744 | WormBase (WB) | WB | available | WB-STRAIN:VC404, CGC_VC404 | 2026-08-29 09:22:46 | 0 | |||
|
plc-3 & srh-135(ve884[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062990 | Caenorhabditis elegans | plc-3 & srh-135(ve884[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. | Made_by: RG KO Group|"umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 6,190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve884 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CTCACTTGGCCCATCATCGTCGTCTCGAAA; Right flanking sequence: TTTTGGAGCATTTTTTATAGTTTAAGTTTA. plc-3_srh-135 sgRNA A: GACTACAGTAACCAGCACAG; plc-3_srh-135 sgRNA B: TTTTGTGGCAAAAAACAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004038(plc-3)|WBGene00004496(rps-27)|WBGene00005352(srh-135)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004038(plc-3), WBGene00004496(rps-27), WBGene00005352(srh-135), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062990 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
D2092.10(ve886[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062991 | Caenorhabditis elegans | D2092.10(ve886[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTATTTATCTGTGGCATTAGCTTTCACCA ; Right flanking sequence: CGGTAATGAGATATCCATTCTGTAAGTTGA. D2092.10 sgRNA A: ATTGAAAGAACTCGCTGAGT; D2092.10 sgRNA B: CTTATACTTCTCTCATTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062991 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
C49F5.5(ve889[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062994 | Caenorhabditis elegans | C49F5.5(ve889[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 881 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAACAGCTGATTTTGTTGCTTCATGCAAA ; Right flanking sequence: TGGCGTGAGTGCCAAAATCGTGCTTGTGCA. C49F5.5 sgRNA A: TGTGTGCACCAAAAGAGACA; C49F5.5 sgRNA B: GTGTTTGATGAGTTGCTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062994 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
M110.3&M110.13(ve887[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062992 | Caenorhabditis elegans | M110.3&M110.13(ve887[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1791 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCAAATAAGAGGAGGAGCGACACTTGAG ; Right flanking sequence: AGGAGAGTTGTGTCGATTTACGCGAGTTGG. M110.3_M110.13 sgRNA A: CACTTCAGCAACCCGTATGG; M110.3_M110.13 sgRNA B: GAGAAATAGCGTGCAAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062992 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
K10B3.1(ve888[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062993 | Caenorhabditis elegans | K10B3.1(ve888[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1215 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATCTCGCATTTACTTTTCTGTCTTCCC ; Right flanking sequence: CGGTAAATCCTATTGTTTCATTGTTTCAAA. K10B3.1 sgRNA A: AAGAACAGAACATTGAGAGG; K10B3.1 sgRNA B: CATTTATCACTGATAGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062993 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
lsd-1(ve894[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062998 | Caenorhabditis elegans | lsd-1(ve894[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 2241 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCTGATAGACCAACGGAAATTGAAGCCG ; Right flanking sequence: GCACACTAGCGCATTGGAACATGGAACATT. lsd-1 sgRNA #2: TCACCAGCAAAAAATACCCG; lsd-1 sgRNA #3: TTGGACTTCTGGGAAAAACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011615(lsd-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011615(lsd-1) | WB-STRAIN:WBStrain00062998 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
K09F6.11 & K09F6.14(ve892[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062996 | Caenorhabditis elegans | K09F6.11 & K09F6.14(ve892[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 451 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAAACTGATTCATTCAGTGTTCTTAACCT ; Right flanking sequence: CGGACGCTGACGACTCTGACGACGATAACG. K09F6.11 sgRNA A: TGTTAGAACCTTTCAGGACA; K09F6.11 sgRNA B: AGCCCAGAAAGACTGTCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062996 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
agt-1(ve931[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063031 | Caenorhabditis elegans | agt-1(ve931[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 840 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGAAAATCTGAGTTCAGCGCCTTCTGCCT ; Right flanking sequence: CGGATGATCATTTCTACTTTAATAAAATTG. agt-1 sgRNA A: GAAGAAGCGTCGCCTATTGC; agt-1 sgRNA B: CGACTTCATAGACGCACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000093(agt-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000093(agt-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063031 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
alh-9(ve932[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063032 | Caenorhabditis elegans | alh-9(ve932[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagttttcgtcgtcataaacaatctgccc ; Right flanking sequence: TGGAGGTCGCGAATCAGGATCCGACTCCTG. alh-9 sgRNA A: gtatgggcggagcgagacac; alh-9 sgRNA B: GGCGGAGAAAAGGAGACCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000115(alh-9)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000115(alh-9), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063032 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
gst-22(ve933[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063033 | Caenorhabditis elegans | gst-22(ve933[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1174 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCATCATTATTTTTTCTTTCACaaaaaaa ; Right flanking sequence: TTTGTAAGAGGGCATATTTTATTTGTGAAG. gst-22 sgRNA A: aCAATTCACACAAGCGTCAC; gst-22 sgRNA B: CTGACTTACTTTGATGCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001770(gst-22)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001770(gst-22), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063033 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
hmg-11(ve872[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062983 | Caenorhabditis elegans | hmg-11(ve872[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 452 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAGAATGAGTGGAGAAGTTGGATCCA ; Right flanking sequence: ACTGGAGAGAAGAAGGGACGTGGACGCCCA. hmg-11 sgRNA #1: ACGAATGCCTTGTTTCTACC; hmg-11 sgRNA #2: CAAAGCAGCAAGAGCCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001976(hmg-11)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001976(hmg-11), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062983 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063038 | Caenorhabditis elegans | let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | Made_by: RG KO Group|"qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002891(let-767)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002891(let-767), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063038 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
T08A11.1(ve878[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062984 | Caenorhabditis elegans | T08A11.1(ve878[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 3532 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGATTCTGATTATTCCACGAAGAACCT ; Right flanking sequence: CGGCCTCATCATAAACTCTCGAATTTCGAT. T08A11.1 sgRNA #1: CCTGCATTGGGTACCAACGG; T08A11.1 sgRNA #2: GGCGAGCACTGCCTGACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062984 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063036 | Caenorhabditis elegans | srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCGAATCTCTCGCATTTTCTCCACTTTC ; Right flanking sequence: TTTTCAAGCAGATCATCCTTTCCTCTTTAT. srp-7 sgRNA A: CATTGCCTTAGCTCTATCTC; srp-7 sgRNA B: ACGATTGGCTTTATAGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005648(srp-7)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005648(srp-7), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063036 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:12 | 0 | ||||
|
+/nT1 [umnIs49] IV; F46B6.6(ve866[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062982 | Caenorhabditis elegans | +/nT1 [umnIs49] IV; F46B6.6(ve866[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3298 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve866 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATGCTAATGTCTAAAATCCTGGTGGATA; Right flanking sequence: CGAATTGTTGAGTTTGAATTCGCCAGAATG. F46B6.6 sgRNA #1: CCAGTCGACTTCTTGAGTGA; F46B6.6 sgRNA #2: CATCTGAAGGAAAACGTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062982 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
F15A4.10(ve882[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062988 | Caenorhabditis elegans | F15A4.10(ve882[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAATACATTTTTTGGCAGAAAGAAAATG ; Right flanking sequence: TGGAAATGGAGGGGTTTGGCTGAAAATTGA. F15A4.10 sgRNA A: AAATTGATATGGATTTGTGG; F15A4.10 sgRNA B: GGACATTTTGCAAGTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00062988 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062985 | Caenorhabditis elegans | ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1932 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTTCAGTCAGCAATTCATGAACTCCT ; Right flanking sequence: CAATCCTACCATTTGATATTAAATGTGATT. ugt-47 sgRNA #1: GAGTGGGTTATTCAGAATGG; ugt-47 sgRNA #2: CTGATGAATTGGCAAAAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011006(ugt-47) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011006(ugt-47) | WB-STRAIN:WBStrain00062985 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.