Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 64 showing 1261 ~ 1280 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_13800746

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800746

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-17)
Alternate IDs: 13800746
Notes: CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13800746 Copy   


  • RRID:RGD_14398828

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398828

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14398828
Notes: This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates

Proper citation: RRID:RGD_14398828 Copy   


  • RRID:RGD_150520210

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520210

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2021-11-05)
Alternate IDs: 150520210
Notes: Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3.

Proper citation: RRID:RGD_150520210 Copy   


  • RRID:RGD_150520052

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520052

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150520052
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mlycd gene of SS/JrHsdMcwi rat embryos. This resulted in a global knock-out of the rat Mlycd gene. Please contact: [email protected]

Proper citation: RRID:RGD_150520052 Copy   


  • RRID:RGD_127284865

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127284865

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127284865
Notes: This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem1Kyo strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_127284865 Copy   


  • RRID:RGD_126925137

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925137

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925137
Notes: The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant.

Proper citation: RRID:RGD_126925137 Copy   


  • RRID:RGD_14975305

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14975305

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14975305
Notes: These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency.

Proper citation: RRID:RGD_14975305 Copy   


  • RRID:RGD_38596327

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38596327

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38596327
Notes: The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) .

Proper citation: RRID:RGD_38596327 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126779586

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126779586
Notes: Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients

Proper citation: RRID:RGD_126779586 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126779592

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126779592
Notes: Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotes

Proper citation: RRID:RGD_126779592 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126928146

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126928146
Notes: The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem1Musc harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletion

Proper citation: RRID:RGD_126928146 Copy   


  • RRID:RGD_149735560

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735560

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-07-22)
Alternate IDs: 149735560
Notes: Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_149735560 Copy   


  • RRID:RGD_38501059

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38501059

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38501059
Notes: The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.

Proper citation: RRID:RGD_38501059 Copy   


  • RRID:RGD_127285810

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=127285810

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 127285810
Notes: This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified.

Proper citation: RRID:RGD_127285810 Copy   


  • RRID:RGD_14394506

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394506

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2019-03-25)
Alternate IDs: 14394506
Notes: CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14394506 Copy   


  • RRID:RGD_14394501

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394501

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2019-03-25)
Alternate IDs: 14394501
Notes: CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14394501 Copy   


  • RRID:RGD_14394621

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394621

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14394621
Notes: The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing.

Proper citation: RRID:RGD_14394621 Copy   


  • RRID:RGD_38501060

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38501060

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38501060
Notes: The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.

Proper citation: RRID:RGD_38501060 Copy   


  • RRID:RGD_38501061

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38501061

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38501061
Notes: The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.

Proper citation: RRID:RGD_38501061 Copy   


  • RRID:RGD_38676461

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676461

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38676461
Notes: HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1.

Proper citation: RRID:RGD_38676461 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X