Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LEW-Rorcem5Mcwi Resource Report Resource Website |
RRID:RGD_10054447 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 59-bp deletion in the Rorc gene. Contact MCW rat distribution at [email protected] | 10054447 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054447 | 2026-09-12 01:25:00 | 0 | |||||
|
SS-F8em2Mcwi Resource Report Resource Website |
RRID:RGD_152975964 | Rattus norvegicus | Full gene inversion of the rat F8 gene introduced by CRISPR/Cas9, to DahlSS background rats. This inversion causes a premature stop codon 3 amino acids into the protein. F8 activity in rats, homozygous for the mutation, is undetectable. Contact MCW Rat Distribution at [email protected] | 152975964 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152975964 | 2026-09-12 01:25:01 | 0 | |||||
|
T2DN-Sirt3em30Mcwi Resource Report Resource Website |
RRID:RGD_10054459 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 31-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054459 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054459 | 2026-09-12 01:25:01 | 0 | |||||
|
SS-Arhgef11em4Mcwi Resource Report Resource Website |
RRID:RGD_10054292 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected] | 10054292 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054292 | 2026-09-12 01:25:02 | 0 | |||||
|
WIC-Cdkn2aem1Kyhs Resource Report Resource Website |
RRID:RGD_152985526 | Rattus norvegicus | A 7-bp deletion in exon 1 of the Cdkn2a (p16) gene was introduced by the CRISPR/Cas9. Genetic background is Iar:Wistar-Imamichi (Institute for Animal Reproduction) (RGD:125097496). Introducing the deletion mutation in the Cdkn2a (p16) gene into the background of DMD rats (muscular dystrophy model rats) improves muscle pathology. National BioResource Project for the Rat in Japan | 152985526 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 152985526 | 2026-09-12 01:25:03 | 0 | |||||
|
SD-Gcgtm1(iCre)Lrina Resource Report Resource Website |
RRID:RGD_155663559 | Rattus norvegicus | CRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR. Strain has been deposited to RRRC(RRRC:00983, RGD:155663560) | 155663559 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2022-11-28) | 155663559 | 2026-09-12 01:25:03 | 0 | |||||
|
SHR-Sbf1m1Ipcv Resource Report Resource Website |
RRID:RGD_10002782 | Rattus norvegicus | Spontaneous mutation in the colony of SHR/OlaIpcv in Prague. | 10002782 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10002782 | 2026-09-12 01:25:04 | 0 | |||||
|
NAR/Slc Resource Report Resource Website |
RRID:RGD_1302678 | Rattus norvegicus | Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan | 1302678 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-09-24) | 1302678 | 2026-09-12 01:25:04 | 0 | |||||
|
SD-Akt1em1Soar Resource Report Resource Website |
RRID:RGD_158013766 | Rattus norvegicus | This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. | 158013766 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 158013766 | 2026-09-12 01:25:40 | 0 | |||||
|
Taiep Resource Report Resource Website |
RRID:RGD_155631259 | Rattus norvegicus | These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats. | 155631259 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631259 | 2026-09-12 01:25:41 | 0 | |||||
|
SD-Pde3aem1Bdr Resource Report Resource Website |
RRID:RGD_155631293 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). | 155631293 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631293 | 2026-09-12 01:25:40 | 0 | |||||
|
SD-Pde3aem2Bdr Resource Report Resource Website |
RRID:RGD_155631295 | Rattus norvegicus | The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL). | 155631295 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631295 | 2026-09-12 01:25:41 | 0 | |||||
|
F344-Txn1 em1Kyo Resource Report Resource Website |
RRID:RGD_288084582 | Rattus norvegicus | This CRISPR/Cas9 induced mutation Phe54Leu is induced in embryos of F344/NSlc. The genome editing system targeting exon 3 of Txn1 gene ( (c. 160 T > C) was delivered into embryos by electroporation. The two-cell stage embryos were transferred into the oviducts of pseudopregnant females. The rat called Txn1-F54L rat, replicates Adem rats (RGD:288084580) which carried Phe54Leu mutation in the same gene.These two strains exhibit similar phenotype. | 288084582 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 288084582 | 2026-09-12 01:25:40 | 0 | |||||
|
WI-Tfap2cem1(tdTomato)Nips Resource Report Resource Website |
RRID:RGD_151665772 | Rattus norvegicus | The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. | 151665772 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2022-04-01) | 151665772 | 2026-09-12 01:25:39 | 0 | |||||
|
SS-Nlrp3em1Mcwi Resource Report Resource Website |
RRID:RGD_13800848 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. Contact MCW rat distribution at [email protected] | 13800848 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800848 | 2026-09-12 01:25:41 | 0 | |||||
|
LE-Scn2aem2Mcwi Resource Report Resource Website |
RRID:RGD_25394532 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 6-bp deletion in exon 5 of the gene. Contact MCW rat distribution at [email protected] | 25394532 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25394532 | 2026-09-12 01:25:41 | 0 | |||||
|
SD-Brca1em1Kyo Resource Report Resource Website |
RRID:RGD_155631261 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9 targeting exon 4 of rat Brca1was injected to fertilized eggs of Jcl:SD rats (Clea Japan). The founder animal carried c.188T>A (p.L63X) was mated to closed-colony Jcl:SD rats. | 155631261 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631261 | 2026-09-12 01:25:41 | 0 | |||||
|
SS-Chr 3BN.SS-(D3Rat164-D3Rat218).Il2rgem1/Mcwi Resource Report Resource Website |
RRID:RGD_155791438 | Rattus norvegicus | Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability. | 155791438 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791438 | 2026-09-12 01:25:41 | 0 | |||||
|
F344-TyrCKitH.LEA-(Tel-D17Got10)/Hkv Resource Report Resource Website |
RRID:RGD_329849010 | Rattus norvegicus | A congenic strain in which a chromosome 17 fragment of LEA rats (provided by Dr. Tadashi Okamura) was introduced into the F344-TyrC KitH (NBRP Rat No. 0768). National BioResource Project for the Rat in Japan | 329849010 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-06-09) | 329849010 | 2026-09-12 01:25:41 | 0 | |||||
|
SD-Ctnsem1Odev Resource Report Resource Website |
RRID:RGD_401938653 | Rattus norvegicus | The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. Contact Olivier Devuyst at Email: [email protected], National BioResource Project for the Rat in Japan | 401938653 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-03-31) | 401938653 | 2026-09-12 01:25:41 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
