Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 63 showing 1241 ~ 1260 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_38599157

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599157

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38599157
Notes: TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National Bio Resource Project Rat in Japan

Proper citation: RRID:RGD_38599157 Copy   


  • RRID:RGD_13792572

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792572

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792572
Notes: The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.NOPr is completely absent in homozygous mutants.

Proper citation: RRID:RGD_13792572 Copy   


  • RRID:RGD_38599206

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599206

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2020-09-15)
Alternate IDs: 38599206
Notes: This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38599206 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126779591

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126779591
Notes: Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. The homozygotes were obtained by crossing of heterozygotes.

Proper citation: RRID:RGD_126779591 Copy   


  • RRID:RGD_41404705

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41404705

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 41404705
Notes: The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. Mount Sinai Medical Center, New York NY 10029 USA

Proper citation: RRID:RGD_41404705 Copy   


  • RRID:RGD_14392815

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14392815

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2019-03-04)
Alternate IDs: 14392815
Notes: CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats are produced by crossing the Cftr heterozygous rats. inotiv

Proper citation: RRID:RGD_14392815 Copy   


  • RRID:RGD_38596339

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38596339

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 38596339
Notes: Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2.

Proper citation: RRID:RGD_38596339 Copy   


  • RRID:RGD_13825143

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825143

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13825143
Notes: CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13825143 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=21083604

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 21083604
Notes: The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Optogenetics and Transgenic Technology Core

Proper citation: RRID:RGD_21083604 Copy   


  • RRID:RGD_14394616

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394616

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 14394616
Notes: This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_14394616 Copy   


  • RRID:RGD_124713546

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713546

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713546
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr (R270L) rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2 diet partially reversed their rickets symptoms. Homozygotes Vdr(R270L mutants were maintained bymating of heterozygotes.

Proper citation: RRID:RGD_124713546 Copy   


  • RRID:RGD_126925212

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925212

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925212
Notes: The Drd1 mutant rat line was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein.

Proper citation: RRID:RGD_126925212 Copy   


  • RRID:RGD_150519899

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150519899

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150519899
Notes: CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant strain F344-Prkar1bem1Tua carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants.

Proper citation: RRID:RGD_150519899 Copy   


  • RRID:RGD_14981588

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14981588

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 14981588
Notes: These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. The strains of both sexes were confirmed Bmpr2 haplodeficiency.

Proper citation: RRID:RGD_14981588 Copy   


  • RRID:RGD_13792607

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792607

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792607
Notes: The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Breeding of CD59 +/- rats was done to generate wildtype (CD59+/+)and homozygous mutant (CD59-/-) rats.

Proper citation: RRID:RGD_13792607 Copy   


  • RRID:RGD_19165133

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165133

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 19165133
Notes: This mutant strain was created by CRISPR/Cas9 genome editing system. The mutant carried insertion of a premature termination codon in exon 2 and was predicted to result in loss of protein expression due to non-sense mediated decay of mRNA. The heterozygous knock out rats (F344/Sprague Dawley mixed background) were bred to each other, and the pups were genotyped to identify the WT and C3 homozygous knock out littermates.

Proper citation: RRID:RGD_19165133 Copy   


  • RRID:RGD_13792683

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792683

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792683
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants.

Proper citation: RRID:RGD_13792683 Copy   


  • RRID:RGD_39456108

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39456108

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 39456108
Notes: TRPV4 gene?specific zinc finger constructs directed against exon 13, containing the coding sequence for part of TM5, the pore region, and TM6, were injected in zygotes from Sprague-Dawley rats. An animal with an 899 bp deletion in the TRPV4 gene was selected as a founder for further breeding. This deletion completely removes exon 13, plus parts of intron 12-13 and intron 13-14 .

Proper citation: RRID:RGD_39456108 Copy   


  • RRID:RGD_126925196

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126925196

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126925196
Notes: This strain was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence.

Proper citation: RRID:RGD_126925196 Copy   


  • RRID:RGD_13782128

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13782128

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2018-08-22)
Alternate IDs: 13782128
Notes: These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. Horizon Discovery

Proper citation: RRID:RGD_13782128 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X