Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RG3016 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033343 | Caenorhabditis elegans | sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-26. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ACGTTTCATATGAGAATCCAGATCTCCATA Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005052(sra-26)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005052(sra-26), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033343 | WormBase (WB) | WB | available | WB-STRAIN:RG3016, CGC_RG3016 | 2026-08-15 09:32:14 | 0 | |||
|
RG3017 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033344 | Caenorhabditis elegans | sra-9(ve517[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-9. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttcagtttcaagatttcATGGCTACCATAG Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005035(sra-9)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005035(sra-9), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033344 | WormBase (WB) | WB | available | WB-STRAIN:RG3017, CGC_RG3017 | 2026-08-15 09:32:14 | 0 | |||
|
RG3032 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033359 | Caenorhabditis elegans | igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of igeg-1. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033359 | WormBase (WB) | WB | available | PMID:39738055 | WB-STRAIN:RG3032, CGC_RG3032 | 2026-08-15 09:32:14 | 0 | ||
|
RG3023 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033350 | Caenorhabditis elegans | sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-30. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctgaaacagtaaattattaactaacCTGAA Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005056(sra-30)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005056(sra-30), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033350 | WormBase (WB) | WB | available | WB-STRAIN:RG3023, CGC_RG3023 | 2026-08-15 09:32:14 | 0 | |||
|
RG3024 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033351 | Caenorhabditis elegans | sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-38. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AATAGCAATGATGAAAACATTAGTGGCATA Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005064(sra-38)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005064(sra-38), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033351 | WormBase (WB) | WB | available | WB-STRAIN:RG3024, CGC_RG3024 | 2026-08-15 09:32:14 | 0 | |||
|
RG3025 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033352 | Caenorhabditis elegans | sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1924 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-25. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA Right flanking sequence: atgacaatttctggatttttgggtacatct" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005051(sra-25)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005051(sra-25), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033352 | WormBase (WB) | WB | available | WB-STRAIN:RG3025, CGC_RG3025 | 2026-08-15 09:32:14 | 0 | |||
|
RG3026 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033353 | Caenorhabditis elegans | sra-7(ve526[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tttcacagtccgttgacttttgatgcaatt Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005033(sra-7)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005033(sra-7), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033353 | WormBase (WB) | WB | available | WB-STRAIN:RG3026, CGC_RG3026 | 2026-08-15 09:32:14 | 0 | |||
|
RG3029 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033356 | Caenorhabditis elegans | C34C6.3(ve529[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C34C6.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aatgattttcagttcagATGCCTTCCTCTG Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033356 | WormBase (WB) | WB | available | WB-STRAIN:RG3029, CGC_RG3029 | 2026-08-15 09:32:14 | 0 | |||
|
RG3008 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033337 | Caenorhabditis elegans | sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-29. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005055(sra-29)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005055(sra-29), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033337 | WormBase (WB) | WB | available | WB-STRAIN:RG3008, CGC_RG3008 | 2026-08-15 09:32:14 | 0 | |||
|
RG3001 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033331 | Caenorhabditis elegans | sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-36. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: acggcatttactcacagaaaatgggaatat Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005062(sra-36)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005062(sra-36), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033331 | WormBase (WB) | WB | available | WB-STRAIN:RG3001, CGC_RG3001 | 2026-08-15 09:32:14 | 0 | |||
|
RG3002 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033332 | Caenorhabditis elegans | sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-1. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: caaatacaaaaaactgtatttaagatgtaa Right flanking sequence: taccaacatgcatgtttcaagaaatctaga" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005027(sra-1)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005027(sra-1), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033332 | WormBase (WB) | WB | available | WB-STRAIN:RG3002, CGC_RG3002 | 2026-08-15 09:32:14 | 0 | |||
|
RG3003 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033333 | Caenorhabditis elegans | sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cagcgtgagaaaaatatcagaatgtgatcg Right flanking sequence: gtgggagattctatcaagagaattcactga" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005029(sra-3)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005029(sra-3), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033333 | WormBase (WB) | WB | available | WB-STRAIN:RG3003, CGC_RG3003 | 2026-08-15 09:32:14 | 0 | |||
|
CGC81 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005010 | Caenorhabditis elegans | C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C09F12.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: taatttacttttactaatttacaatttacattaacttttcattatttcag Right flanking sequence: tggatgtgcattttttcgctgctcactctttatgaaatctataaaagtcg" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00005010 | WormBase (WB) | WB | available | WB-STRAIN:CGC81, CGC_CGC81 | 2026-08-15 09:23:45 | 0 | |||
|
CGC73 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005003 | Caenorhabditis elegans | npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-28. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tatttcacgccttcccactctatttggtatcatttttctagccgactttc Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGATGATTGTCACAGACGTATAT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018886(npr-28) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018886(npr-28) | WB-STRAIN:WBStrain00005003 | WormBase (WB) | WB | available | WB-STRAIN:CGC73, CGC_CGC73 | 2026-08-15 09:23:45 | 0 | |||
|
CK423 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005045 | Caenorhabditis elegans | [Psnb-1::TDP-43(M337V), Pmyo-2::dsRED] | Psnb-1::TDP-43 (M337V)|"[2020-05-27T21:32:03.517Z WBPerson324] Adding data Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(M337V), Pmyo-2::dsRED]" | WBGene00003514(myo-2)|WBGene00004897(snb-1) | WBGene00003514(myo-2), WBGene00004897(snb-1) | WB-STRAIN:WBStrain00005045 | WormBase (WB) | WB | unknown | PMID:21123567 PMID:37118550 PMID:39724103 |
WB-STRAIN:CK423 | 2026-08-15 09:23:46 | 0 | ||
|
CLP215 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005116 | Caenorhabditis elegans | twnEx8. | twnEx8 (mec-7p::tomm20::mCherry + myo-2p::GFP). Punctate mCherry signals denote mitochondria in six touch neurons. Pick animals GFP+ in the pharynx to maintain. Reference: Jiang HC, et al. Proc Natl Acad Sci U S A. 2015 Jul 14;112(28):8768-73.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WBGene00003171(mec-7)|WBGene00003514(myo-2) | WBGene00003171(mec-7), WBGene00003514(myo-2) | WB-STRAIN:WBStrain00005116 | WormBase (WB) | WB | available | WB-STRAIN:CLP215, CGC_CLP215 | 2026-08-15 09:23:47 | 1 | |||
|
DA1556 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005576 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003514(myo-2) | WBGene00003514(myo-2) | WB-STRAIN:WBStrain00005576 | WormBase (WB) | WB | unknown | WB-STRAIN:DA1556 | 2026-08-15 09:23:56 | 0 | |||
|
JU944 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00023123 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00002018(hsp-16.41)|WBGene00003514(myo-2)|WBGene00003848(odr-1) | WBGene00002018(hsp-16.41), WBGene00003514(myo-2), WBGene00003848(odr-1) | WB-STRAIN:WBStrain00023123 | WormBase (WB) | WB | unknown | WB-STRAIN:JU944 | 2026-08-15 09:29:09 | 0 | |||
|
VC3974 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037862 | Caenorhabditis elegans | C06G4.1(gk5052[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037862 | WormBase (WB) | WB | available | WB-STRAIN:VC3974, CGC_VC3974 | 2026-08-15 09:33:34 | 0 | |||
|
VC3985 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037867 | Caenorhabditis elegans | cfim-2(gk5017[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. | Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by nT1. Deletion of 2670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTTGAGGATTGATGGCTGAATTGGAC; Right flanking sequence: ATTAAATAACACGACTTTCTTCAAATTCAA. See WormBase Variation gk5017 for details." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008362(cfim-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008362(cfim-2) | WB-STRAIN:WBStrain00037867 | WormBase (WB) | WB | available | WB-STRAIN:VC3985, CGC_VC3985 | 2026-08-15 09:33:34 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
