Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054788
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
References:
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Alternate IDs:
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.
Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy
http://www.wormbase.org/db/get?name=WBStrain00055739
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
References:
Synonyms: dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Alternate IDs:
Notes: This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002."
Proper citation: RRID:WB-STRAIN:WBStrain00055739 Copy
http://www.wormbase.org/db/get?name=WBStrain00037915
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
References:
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4098, CGC_VC4098
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy
http://www.wormbase.org/db/get?name=WBStrain00006665
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003055(lon-1)|WBGene00004397(rol-6)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003055(lon-1), WBGene00004397(rol-6)
Availability: available
References:
Synonyms: dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III.
Alternate IDs: WB-STRAIN:EG1000, CGC_EG1000
Notes: Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a C shape, and lon-1 worms are about 125% WT length.|"WBStrain provided so WBPaper00060449 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006665 Copy
http://www.wormbase.org/db/get?name=WBStrain00007169
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001864(him-5)|WBGene00004299(ram-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001864(him-5), WBGene00004299(ram-1)
Availability: available
References:
Synonyms: dpy-5(e61) ram-1(bx34) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM140, CGC_EM140
Notes: Dpy. Rays abnormal.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007169 Copy
http://www.wormbase.org/db/get?name=WBStrain00007277
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003395(mom-2)|WBGene00003396(mom-4)|WBGene00006778(unc-42)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003395(mom-2), WBGene00003396(mom-4), WBGene00006778(unc-42)
Availability: available
References:
Synonyms: dpy-5(e61) mom-4(or39)/hT1 I; mom-2(or42) unc-42(e270)/hT1 V.
Alternate IDs: WB-STRAIN:EU423, CGC_EU423
Notes: Heterozygotes are WT.
Proper citation: RRID:WB-STRAIN:WBStrain00007277 Copy
http://www.wormbase.org/db/get?name=WBStrain00007643
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: tmC18 [dpy-5(tm9705)] I.
Alternate IDs: WB-STRAIN:FX30238, CGC_FX30238
Notes: Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.|"Made_by: Mitani Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00007643 Copy
http://www.wormbase.org/db/get?name=WBStrain00007640
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: tmC20 [dpy-5(tm9709)] I.
Alternate IDs: WB-STRAIN:FX30235, CGC_FX30235
Notes: Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.|"Made_by: Mitani Lab"|"Supplementary_genotype tmC20 [dpy-5(tm9709)] I"
Proper citation: RRID:WB-STRAIN:WBStrain00007640 Copy
http://www.wormbase.org/db/get?name=WBStrain00007738
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001070(dpy-8)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001070(dpy-8), WBGene00003056(lon-2)
Availability: available
References:
Synonyms: tDf4 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X.
Alternate IDs: WB-STRAIN:GE1549, CGC_GE1549
Notes: Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. Strain will occasionally throw some DpysRollers.
Proper citation: RRID:WB-STRAIN:WBStrain00007738 Copy
http://www.wormbase.org/db/get?name=WBStrain00007737
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001070(dpy-8)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001070(dpy-8), WBGene00003056(lon-2)
Availability: available
References:
Synonyms: tDf3 dpy-5(e61)/szT1 [lon-2(e678)] I; dpy-8(sc44)/szT1 X.
Alternate IDs: WB-STRAIN:GE1386, CGC_GE1386
Notes: Heterozygotes are WT and segregate WT, Lon males and dead eggs. Strain will occasionally throw some DpysRollers.
Proper citation: RRID:WB-STRAIN:WBStrain00007737 Copy
http://www.wormbase.org/db/get?name=WBStrain00007734
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000504(cib-1)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000504(cib-1), WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: cib-1(e2300) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:GE974, CGC_GE974
Notes: Dpy. cib-1 is a temperature sensitive maternal effect lethal. Grow at 15C. Produces dead eggs at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00007734 Copy
http://www.wormbase.org/db/get?name=WBStrain00007987
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000871(cye-1)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000871(cye-1), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: dpy-5(e61) cye-1(ar95)/unc-13(e51) I.
Alternate IDs: WB-STRAIN:GS307, CGC_GS307
Notes: Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. ar95 previously called evl-10(ar95). See also WBPaper00004382. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00007987 Copy
http://www.wormbase.org/db/get?name=WBStrain00007986
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001355(evl-17)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001355(evl-17), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: evl-17(ar94)/dpy-5(e61) unc-13(e51) I.
Alternate IDs: WB-STRAIN:GS305, CGC_GS305
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00007986 Copy
http://www.wormbase.org/db/get?name=WBStrain00008014
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001349(evl-9)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001349(evl-9), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: evl-9(ar121)/dpy-5(e61) unc-13(e51) I.
Alternate IDs: WB-STRAIN:GS454, CGC_GS454
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00008014 Copy
http://www.wormbase.org/db/get?name=WBStrain00002753
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00008547(F07A11.4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00008547(F07A11.4)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx13830.
Alternate IDs: WB-STRAIN:BC13830, CGC_BC13830
Notes: Made_by: Baillie Lab|"sEx13830 [rCes F07A11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00002753 Copy
http://www.wormbase.org/db/get?name=WBStrain00002751
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002262(ldh-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002262(ldh-1)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx13826.
Alternate IDs: WB-STRAIN:BC13826, CGC_BC13826
Notes: Made_by: Baillie Lab|"sEx13826 [rCes F13D12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00002751 Copy
http://www.wormbase.org/db/get?name=WBStrain00002750
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx13824.
Alternate IDs: WB-STRAIN:BC13824, CGC_BC13824
Notes: sEx13824 [rCesF19H6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00002750 Copy
http://www.wormbase.org/db/get?name=WBStrain00002800
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx13954.
Alternate IDs: WB-STRAIN:BC13954, CGC_BC13954
Notes: sEx13954 [rCesF10E7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00002800 Copy
http://www.wormbase.org/db/get?name=WBStrain00002764
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002280(let-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002280(let-2)
Availability: available
References:
Synonyms: dpy-5(e907) I; sIs13252.
Alternate IDs: WB-STRAIN:BC13861, CGC_BC13861
Notes: Made_by: Tony Luo|"sIs13252[rCesF01G12.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00002764 Copy
http://www.wormbase.org/db/get?name=WBStrain00002766
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx13865.
Alternate IDs: WB-STRAIN:BC13865, CGC_BC13865
Notes: sEx13865 [rCesY17G9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00002766 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
