Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00004368

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006805(unc-73)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006805(unc-73)
Availability: available
Source References: EMPTY
Synonyms: unc-73(e936) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:CB2067, CGC_CB2067
Notes: UncDpy.

Proper citation: RRID:WB-STRAIN:WBStrain00004368 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00004485

Source Database: WormBase (WB)
Affected Genes: WBGene00000140(anc-1)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000140(anc-1), WBGene00001067(dpy-5)
Availability: available
Source References: PMID:6889924
Synonyms: anc-1(e1802) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:CB3432, CGC_CB3432
Notes: Dpy. Nuclei not anchored in certain epithelial cells.

Proper citation: RRID:WB-STRAIN:WBStrain00004485 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00000065

Source Database: WormBase (WB)
Affected Genes: WBGene00000386(cdc-25.1)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000386(cdc-25.1), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: WBPaper00029620(PMID:EMPTY)
Synonyms: cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I.
Alternate IDs: WB-STRAIN:AG151, CGC_AG151
Notes: Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.|"Made_by: Ashcroft/Golden"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00000065 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00049794

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001864(him-5)|WBGene00003396(mom-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001864(him-5), WBGene00003396(mom-4)
Availability: unknown
Source References: PMID:33713117
Synonyms: dpy-5(e61) mom-4(or39) I/hT1 (I;III); him-5(e1490) V
Notes: Batch Strain object requested via get_NS_ids.pl

Proper citation: RRID:WB-STRAIN:WBStrain00049794 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054650

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00009163(drsh-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00009163(drsh-1)
Availability: unknown
Source References: EMPTY
Synonyms: drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I.
Notes: Made_by: J. H. Seemann|"[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010."

Proper citation: RRID:WB-STRAIN:WBStrain00054650 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00055439

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004389(rnp-6)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004389(rnp-6), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I.
Notes: Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055439 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062742

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062742 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062924

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5::mNG(syb3312) I.
Notes: Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous dpy-5 locus."

Proper citation: RRID:WB-STRAIN:WBStrain00062924 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062917

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004479(rps-10)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004479(rps-10), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I.
Notes: Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.|"Made_by: Elif Sarinay Cenik & Agustian Surya"

Proper citation: RRID:WB-STRAIN:WBStrain00062917 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052037

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Made_by: UDN Screening Center|"rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052037 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052054

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Made_by: UDN Screening Center|"rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052054 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052050

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II.
Notes: Made_by: UDN Screening Center|"udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658"

Proper citation: RRID:WB-STRAIN:WBStrain00052050 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052049

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center"

Proper citation: RRID:WB-STRAIN:WBStrain00052049 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00052038

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658|"Made_by: UDN Screening Center"

Proper citation: RRID:WB-STRAIN:WBStrain00052038 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00030675

Source Database: WormBase (WB)
Affected Genes: WBGene00000485(che-3)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000485(che-3), WBGene00001067(dpy-5)
Availability: available
Source References: PMID:3596232
Synonyms: che-3(hf5) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:PH32, CGC_PH32
Notes: Dpy. Resistant to caffeine. Previously called caf-2(hf5).

Proper citation: RRID:WB-STRAIN:WBStrain00030675 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034653

Source Database: WormBase (WB)
Affected Genes: WBGene00000431(ceh-6)|WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000431(ceh-6), WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: WBPaper00014592(PMID:EMPTY)
Synonyms: ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I.
Alternate IDs: WB-STRAIN:TB1, CGC_TB1
Notes: ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.|"Made_by: Tom Burglin"

Proper citation: RRID:WB-STRAIN:WBStrain00034653 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00033500

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003934(pat-10)|WBGene00006774(unc-38)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003934(pat-10), WBGene00006774(unc-38)
Availability: available
Source References: PMID:8106547
Synonyms: unc-38(x20) pat-10(st568)/unc-38(x20) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:RW1383, CGC_RW1383
Notes: Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).

Proper citation: RRID:WB-STRAIN:WBStrain00033500 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00033517

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003935(pat-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003935(pat-11)
Availability: available
Source References: PMID:8106547
Synonyms: pat-11(st541)/dpy-5(e61) I.
Alternate IDs: WB-STRAIN:RW3518, CGC_RW3518
Notes: Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.

Proper citation: RRID:WB-STRAIN:WBStrain00033517 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00004957

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:CGC26, CGC_CGC26
Notes: umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

Proper citation: RRID:WB-STRAIN:WBStrain00004957 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00004983

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III.
Alternate IDs: WB-STRAIN:CGC52, CGC_CGC52
Notes: umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

Proper citation: RRID:WB-STRAIN:WBStrain00004983 Copy   

•   Source: Integrated Animals