Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00023706
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002707(let-516)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002707(let-516), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: let-516(h144) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR470, CGC_KR470
Notes: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile adults.
Proper citation: RRID:WB-STRAIN:WBStrain00023706 Copy
http://www.wormbase.org/db/get?name=WBStrain00023787
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002697(let-505)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002697(let-505), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: let-505(h426) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR751, CGC_KR751
Notes: Animals with the duplication are Unc. Animals which have lost the duplication arrest in embyronic development.
Proper citation: RRID:WB-STRAIN:WBStrain00023787 Copy
http://www.wormbase.org/db/get?name=WBStrain00023784
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002806(let-632)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002806(let-632), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: let-632(h419) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR744, CGC_KR744
Notes: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.
Proper citation: RRID:WB-STRAIN:WBStrain00023784 Copy
http://www.wormbase.org/db/get?name=WBStrain00026620
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003170(mec-6)|WBGene00006748(unc-8)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003170(mec-6), WBGene00006748(unc-8)
Availability: available
References:
Synonyms: dpy-5(e61) mec-6(lb84) I; unc-8(n491) IV.
Alternate IDs: WB-STRAIN:MP84, CGC_MP84
Notes: Dpy.
Proper citation: RRID:WB-STRAIN:WBStrain00026620 Copy
http://www.wormbase.org/db/get?name=WBStrain00026735
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000252(bli-2)|WBGene00001067(dpy-5)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00000252(bli-2), WBGene00001067(dpy-5), WBGene00006768(unc-32)
Availability: available
References:
Synonyms: dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III.
Alternate IDs: WB-STRAIN:MT465, CGC_MT465
Notes: Made_by: Tsung/Horvitz|"Mapping strain. DpyUnc."
Proper citation: RRID:WB-STRAIN:WBStrain00026735 Copy
http://www.wormbase.org/db/get?name=WBStrain00026847
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003056(lon-2)|WBGene00003156(mcm-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003056(lon-2), WBGene00003156(mcm-4)
Availability: available
References:
Synonyms: mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:MT1442, CGC_MT1442
Notes: Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00026847 Copy
http://www.wormbase.org/db/get?name=WBStrain00027045
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00004773(sem-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004773(sem-4)
Availability: available
References:
Synonyms: dpy-5(e61) sem-4(n1378) I.
Alternate IDs: WB-STRAIN:MT3213, CGC_MT3213
Notes: Dpy. Egl. Transformation of sex myoblasts into body wall muscle.
Proper citation: RRID:WB-STRAIN:WBStrain00027045 Copy
http://www.wormbase.org/db/get?name=WBStrain00027088
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00004397(rol-6)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004397(rol-6), WBGene00006768(unc-32)
Availability: available
References:
Synonyms: dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III.
Alternate IDs: WB-STRAIN:MT3751, CGC_MT3751
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00027088 Copy
http://www.wormbase.org/db/get?name=WBStrain00027279
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003186(mek-2)|WBGene00006320(sup-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003186(mek-2), WBGene00006320(sup-11)
Availability: available
References:
Synonyms: mek-2(n2679)/sup-11(n403) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT7026, CGC_MT7026
Notes: Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.
Proper citation: RRID:WB-STRAIN:WBStrain00027279 Copy
http://www.wormbase.org/db/get?name=WBStrain00027269
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002248(lam-3)|WBGene00006807(unc-75)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002248(lam-3), WBGene00006807(unc-75)
Availability: available
References:
Synonyms: lam-3(n2561)/dpy-5(e61) unc-75(e950) I.
Alternate IDs: WB-STRAIN:MT6550, CGC_MT6550
Notes: Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.
Proper citation: RRID:WB-STRAIN:WBStrain00027269 Copy
http://www.wormbase.org/db/get?name=WBStrain00054788
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
References:
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Alternate IDs:
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.
Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy
http://www.wormbase.org/db/get?name=WBStrain00055739
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
References:
Synonyms: dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Alternate IDs:
Notes: This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002."
Proper citation: RRID:WB-STRAIN:WBStrain00055739 Copy
http://www.wormbase.org/db/get?name=WBStrain00033905
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: dpy-5(e61) unc-13(e51) I; gaDp1 (I;f).
Alternate IDs: WB-STRAIN:SD63, CGC_SD63
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00033905 Copy
http://www.wormbase.org/db/get?name=WBStrain00034126
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.
Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy
http://www.wormbase.org/db/get?name=WBStrain00040443
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: dpy-5(e61) unc-13(e51) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:WM149, CGC_WM149
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.
Proper citation: RRID:WB-STRAIN:WBStrain00040443 Copy
http://www.wormbase.org/db/get?name=WBStrain00040929
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006797(unc-63)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006797(unc-63)
Availability: available
References:
Synonyms: unc-63(x18) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1004, CGC_ZZ1004
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040929 Copy
http://www.wormbase.org/db/get?name=WBStrain00040931
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006774(unc-38)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006774(unc-38)
Availability: available
References:
Synonyms: unc-38(x20) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1015, CGC_ZZ1015
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040931 Copy
http://www.wormbase.org/db/get?name=WBStrain00042266
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
References:
Synonyms: dpy-5(e907) I; sIs13146.
Alternate IDs: WB-STRAIN:BC13585
Notes: Generated based on WC-CalTech XREF data|"No longer available from the CGC catalogue 24/04/2020"|"sIs13146 [rCes C02H7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00042266 Copy
http://www.wormbase.org/db/get?name=WBStrain00050604
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
References:
Synonyms: rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I.
Alternate IDs:
Notes: Made_by: UDN Screening Center|"Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658"|"[2022-03-09T03:06:44.75Z WBPerson324] New Strain: rab-5(udn14)/tmC18[dpy5(tmIs1200[myo-2p::Venus])] I"|"[2022-03-09T03:28:46.878Z WBPerson324] Strain: WBPaper00062455; Genotype: rab-5(udn14)/tmC18[dpy5(tmIs1200[myo-2p::Venus])] I"
Proper citation: RRID:WB-STRAIN:WBStrain00050604 Copy
http://www.wormbase.org/db/get?name=WBStrain00050671
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00002225(klp-15)|WBGene00002226(klp-16)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002225(klp-15), WBGene00002226(klp-16)
Availability: unknown
References:
Synonyms: klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57.
Alternate IDs:
Notes: itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020|"ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020"
Proper citation: RRID:WB-STRAIN:WBStrain00050671 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
