Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 58 showing 1141 ~ 1160 out of 2,338 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00023911

http://www.wormbase.org/db/get?name=WBStrain00023911

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp41 (I;f).
Alternate IDs: WB-STRAIN:KR1628, CGC_KR1628
Notes: Mutagen:Gamma Rays|"Unc-13 phenotype. Segregates Uncs and DpyUncs. The Uncs are slow growing; the DpyUncs will take over the population. Pick several Unc-13 animals and check for correct segregation of progeny to maintain. This duplication was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023911 Copy   


  • RRID:WB-STRAIN:WBStrain00023912

http://www.wormbase.org/db/get?name=WBStrain00023912

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp39 (I;f).
Alternate IDs: WB-STRAIN:KR1630, CGC_KR1630
Notes: Made_by: McKim K|"Mutagen:3000 R gamma"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13 progeny. Duplication-bearing animals are slow-growing, and DpyUncs will take over population. Pick several Unc-13 animals and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023912 Copy   


  • RRID:WB-STRAIN:WBStrain00023914

http://www.wormbase.org/db/get?name=WBStrain00023914

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; hDp54 (I;f).
Alternate IDs: WB-STRAIN:KR1635, CGC_KR1635
Notes: 1500 R gamma|"Made_by: McKim K"|"Mutagen:Gamma rays"|"Unc-13 phenotype. Segregates Unc-13 and Dpy-5 Unc-13. Pick Unc-13 and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023914 Copy   


  • RRID:WB-STRAIN:WBStrain00023906

http://www.wormbase.org/db/get?name=WBStrain00023906

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002728(let-538)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002728(let-538), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) unc-13(e450) let-538(h990)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1598, CGC_KR1598
Notes: Wild-type phenotype. Segregates WT, sterile adult DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.

Proper citation: RRID:WB-STRAIN:WBStrain00023906 Copy   


  • RRID:WB-STRAIN:WBStrain00023907

http://www.wormbase.org/db/get?name=WBStrain00023907

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) unc-13(e450) I; hDp32 (I;f).
Alternate IDs: WB-STRAIN:KR1620, CGC_KR1620
Notes: Mutagen:Gamma Rays|"Unc-13 phenotype. Segregates Uncs and DpyUncs. The Unc-13 animals are slow growing and DpyUncs will take over; pick several Unc-13 animals to a plate to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023907 Copy   


  • RRID:WB-STRAIN:WBStrain00023903

http://www.wormbase.org/db/get?name=WBStrain00023903

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) unc-13(e450) I; szDp1 (I;X;f).
Alternate IDs: WB-STRAIN:KR1577, CGC_KR1577
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023903 Copy   


  • RRID:WB-STRAIN:WBStrain00023939

http://www.wormbase.org/db/get?name=WBStrain00023939

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp43 (I;f).
Alternate IDs: WB-STRAIN:KR1778, CGC_KR1778
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023939 Copy   


  • RRID:WB-STRAIN:WBStrain00023938

http://www.wormbase.org/db/get?name=WBStrain00023938

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp58 (I;f).
Alternate IDs: WB-STRAIN:KR1775, CGC_KR1775
Notes: This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Proper citation: RRID:WB-STRAIN:WBStrain00023938 Copy   


  • RRID:WB-STRAIN:WBStrain00023935

http://www.wormbase.org/db/get?name=WBStrain00023935

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006806(unc-74)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006806(unc-74)
Availability: available
Source References: PMID:2307351
Synonyms: unc-74(x19) dpy-5(e61) I; hDp29 (I;f).
Alternate IDs: WB-STRAIN:KR1754, CGC_KR1754
Notes: spontaneous from hDp5|"Unc. Segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023935 Copy   


  • RRID:WB-STRAIN:WBStrain00023923

http://www.wormbase.org/db/get?name=WBStrain00023923

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:9230900
Synonyms: dpy-5(e61) unc-13(e450) I; hDp60 (I;f).
Alternate IDs: WB-STRAIN:KR1697, CGC_KR1697
Notes: Mutagen:Gamma Rays|"Unc-13 phenotype. Segregates Uncs and DpyUncs. The Unc-13 animals are slow growing and DpyUncs will take over; pick several Unc-13 animals to a plate to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023923 Copy   


  • RRID:WB-STRAIN:WBStrain00023921

http://www.wormbase.org/db/get?name=WBStrain00023921

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002726(let-535)|WBGene00003056(lon-2)|WBGene00006752(unc-13)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002726(let-535), WBGene00003056(lon-2), WBGene00006752(unc-13), WBGene00006765(unc-29)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) unc-13(e450) let-535(h993)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:KR1692, CGC_KR1692
Notes: Wild-type phenotype. Segregates WT, mid-larval arrested DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.

Proper citation: RRID:WB-STRAIN:WBStrain00023921 Copy   


  • RRID:WB-STRAIN:WBStrain00023944

http://www.wormbase.org/db/get?name=WBStrain00023944

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp30 (I;f).
Alternate IDs: WB-STRAIN:KR1815, CGC_KR1815
Notes: Dpy-14 phenotype. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"spontaneous from hDp23"

Proper citation: RRID:WB-STRAIN:WBStrain00023944 Copy   


  • RRID:WB-STRAIN:WBStrain00023945

http://www.wormbase.org/db/get?name=WBStrain00023945

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp72 (I;f).
Alternate IDs: WB-STRAIN:KR1817, CGC_KR1817
Notes: Animals with the duplication are Dpy. Animals which have lost the duplication are extremely Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Made_by: K. McKim"

Proper citation: RRID:WB-STRAIN:WBStrain00023945 Copy   


  • RRID:WB-STRAIN:WBStrain00023943

http://www.wormbase.org/db/get?name=WBStrain00023943

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180) I; hDp75 (I;f).
Alternate IDs: WB-STRAIN:KR1800, CGC_KR1800
Notes: Made_by: McKim K|"Spontaneous from sDp2"|"Wild-type phenotype. Segregates WT, Dpy-5 Dpy-14 Rec-1. Presence of rec-1 not confirmed. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023943 Copy   


  • RRID:WB-STRAIN:WBStrain00023949

http://www.wormbase.org/db/get?name=WBStrain00023949

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14)
Availability: available
Source References: PMID:7958823
Synonyms: dpy-5(e61) dpy-14(e188) I; hDp83 (I;IV).
Alternate IDs: WB-STRAIN:KR1901, CGC_KR1901
Notes: Made_by: K. McKim|"Stable and homozygous viable. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023949 Copy   


  • RRID:WB-STRAIN:WBStrain00023946

http://www.wormbase.org/db/get?name=WBStrain00023946

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:2307351
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp20 (I;V).
Alternate IDs: WB-STRAIN:KR1836, CGC_KR1836
Notes: Mutagen:gamma on sDp2|"WT. Dp carries Chromosome I and V left sequences. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."

Proper citation: RRID:WB-STRAIN:WBStrain00023946 Copy   


  • RRID:WB-STRAIN:WBStrain00023947

http://www.wormbase.org/db/get?name=WBStrain00023947

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001069(dpy-7)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001069(dpy-7), WBGene00006743(unc-3)
Availability: unknown
Source References: PMID:36617680
Synonyms: +/hT3[dpy-5(e61)] I; dpy-7(e88) unc-3(e151)/hT3 X.
Alternate IDs: WB-STRAIN:KR1876
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Dpys.|"Heterozygotes are WT and segregate WT, DpyUncs and Dpys. Balancer is quite unstable and prone to breaking down. Grows better at 15C."|"no longer available from the CGC."|"Supplementary_genotype +/hT3[dpy-5(e61)] I; dpy-7(e88) unc-3(e151)/hT3 X."

Proper citation: RRID:WB-STRAIN:WBStrain00023947 Copy   


  • RRID:WB-STRAIN:WBStrain00037915

http://www.wormbase.org/db/get?name=WBStrain00037915

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
Source References: EMPTY
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4098, CGC_VC4098
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy   


  • RRID:WB-STRAIN:WBStrain00040443

http://www.wormbase.org/db/get?name=WBStrain00040443

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-13(e51) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:WM149, CGC_WM149
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.

Proper citation: RRID:WB-STRAIN:WBStrain00040443 Copy   


  • RRID:WB-STRAIN:WBStrain00040929

http://www.wormbase.org/db/get?name=WBStrain00040929

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006797(unc-63)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006797(unc-63)
Availability: available
Source References: EMPTY
Synonyms: unc-63(x18) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1004, CGC_ZZ1004
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00040929 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X