Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
HiSER/Hat Resource Report Resource Website |
RRID:RGD_38676461 | Rattus norvegicus | HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. | 38676461 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38676461 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Eif2ak4em1 Resource Report Resource Website |
RRID:RGD_38549372 | Rattus norvegicus | The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. | 38549372 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38549372 | 2026-09-12 01:25:37 | 0 | |||||
|
W.F344-Lepm1Kyo Resource Report Resource Website |
RRID:RGD_38599197 | Rattus norvegicus | This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672). National BioResource Project for the Rat in Japan | 38599197 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2020-09-14) | 38599197 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Nr3c1em1Jhrmn Resource Report Resource Website 1+ mentions |
RRID:RGD_125097486 | Rattus norvegicus | CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) Strain deposited with the RRRC | 125097486 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 125097486 | 2026-09-12 01:25:37 | 1 | |||||
|
LEW-Glp1rem2Mcwi Resource Report Resource Website |
RRID:RGD_14394488 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] | 14394488 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2026-02-19) | 14394488 | 2026-09-12 01:25:37 | 0 | |||||
|
F344-Nppcem4Kyo Resource Report Resource Website |
RRID:RGD_127284872 | Rattus norvegicus | This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem4Kyo strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats. National BioResource Project for the Rat in Japan | 127284872 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127284872 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Apoeem1Dlli Resource Report Resource Website |
RRID:RGD_150520186 | Rattus norvegicus | carried a 130 bp deletion from No.80613571bp to 80613700bp in Apoe gene (NC_005100.4), resulting in a termination codon TAA, and deletion of 231 amino acids of ApoE. | 150520186 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520186 | 2026-09-12 01:25:37 | 0 | |||||
|
LE-Apoeem1DlliLdlrem1Ldlr Resource Report Resource Website |
RRID:RGD_150520187 | Rattus norvegicus | This Apoe/Ldlr double knock-out (DKO) was derived from cross-breeding of SD-Apoeem1Dlli (RGD:150520186) and SD-Ldlrem1Dlli (150520185). | 150520187 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520187 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Ccdc39em1Jgn Resource Report Resource Website |
RRID:RGD_150520220 | Rattus norvegicus | The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. | 150520220 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520220 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Defb23em1Mlit Resource Report Resource Website |
RRID:RGD_38549353 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. | 38549353 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38549353 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Defb26em1Mlit Resource Report Resource Website |
RRID:RGD_38549354 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. | 38549354 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38549354 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Ngly1em1Ta-/- Resource Report Resource Website |
RRID:RGD_39457950 | Rattus norvegicus | The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats. Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats. Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile." National BioResource Project for the Rat in Japan | 39457950 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-07-22) | 39457950 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Defb42em1Mlit Resource Report Resource Website |
RRID:RGD_38549355 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. | 38549355 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38549355 | 2026-09-12 01:25:37 | 0 | |||||
|
BN-Lx/CubMcwi Resource Report Resource Website |
RRID:RGD_38676495 | Rattus norvegicus | These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. RGD HRDP, contact Hybrid Rat Diversity Program at [email protected] | 38676495 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2024-08-06) | 38676495 | 2026-09-12 01:25:37 | 0 | |||||
|
FHH-Chr 1BN-Add3em2Mcwi /Roman Resource Report Resource Website |
RRID:RGD_150429618 | Rattus norvegicus | ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used | 150429618 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429618 | 2026-09-12 01:25:36 | 0 | |||||
|
WI- Lpar1m1Hubr Resource Report Resource Website |
RRID:RGD_39457945 | Rattus norvegicus | The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2. | 39457945 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 39457945 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Adgrl3em1Huyc Resource Report Resource Website |
RRID:RGD_127285661 | Rattus norvegicus | The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. | 127285661 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127285661 | 2026-09-12 01:25:38 | 0 | |||||
|
BN-Aireem1Ang-/- Resource Report Resource Website |
RRID:RGD_38599146 | Rattus norvegicus | The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. | 38599146 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599146 | 2026-09-12 01:25:37 | 0 | |||||
|
SS-Xdhem1Mcwi-/- Resource Report Resource Website |
RRID:RGD_14398479 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. There was no Xdh protein detected in the kidney cortex tissue of 6-week old homozygous mutants. Contact MCW rat distribution at [email protected] | 14398479 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-05-29) | 14398479 | 2026-09-12 01:25:38 | 0 | |||||
|
SD-Ephx2em2Mcwi Resource Report Resource Website |
RRID:RGD_25394528 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. Contact MCW rat distribution at [email protected] | 25394528 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 25394528 | 2026-09-12 01:25:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.