Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713544
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713544
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes.
Proper citation: RRID:RGD_124713544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=15036806
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown (as of 2019-11-18)
Synonyms: , WKA
Alternate IDs: 15036806
Notes: WKAH/Tj inbred rats were bred in the Institute for Animal Experimentation, the University of Tokushima School of Medicine, under specific pathogen free conditions.
Proper citation: RRID:RGD_15036806 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126790496
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 126790496
Notes: The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA
Proper citation: RRID:RGD_126790496 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124713548
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 124713548
Notes: This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array
near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes.
Proper citation: RRID:RGD_124713548 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=126848776
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Live Animals (as of 2021-04-30)
Alternate IDs: 126848776
Notes: This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for wild type Mertk gene. CLEA Japan, Inc
Proper citation: RRID:RGD_126848776 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=40924650
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 40924650
Notes: Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649).
Proper citation: RRID:RGD_40924650 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735521
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 149735521
Notes: These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub RGD HRDP, contact HRDP
Proper citation: RRID:RGD_149735521 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792606
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792606
Notes: The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.
Proper citation: RRID:RGD_13792606 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=21079475
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 21079475
Notes: The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.
Proper citation: RRID:RGD_21079475 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792682
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13792682
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Proper citation: RRID:RGD_13792682 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429602
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 150429602
Notes: The congenic MWF.SHR-(D6Rat1-D6Rat106)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.
Proper citation: RRID:RGD_150429602 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429601
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 150429601
Notes: The congenic MWF.SHR-(D6Rat1-D6Rat30)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.
Proper citation: RRID:RGD_150429601 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429963
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 150429963
Notes: The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.
Proper citation: RRID:RGD_150429963 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735517
Source Database: Rat Genome Database (RGD)
Genetic Background: recombinant_inbred
Availability: Unknown
Alternate IDs: 149735517
Notes: These are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. RGD HRDP, contact HRDP
Proper citation: RRID:RGD_149735517 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735516
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals (as of 2024-08-06)
Alternate IDs: 149735516
Notes: In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. The strain from Rat Resource & Research Center was maintained at Department of Pharmacology, University of Iowa RGD HRDP, contact HRDP
Proper citation: RRID:RGD_149735516 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39456107
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 39456107
Notes: The LE/StmMcwi was rederived from LE/Stm and maintained at Medical College of Wisconsin. The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. RGD HRDP, contact Hybrid Rat Diversity program at
[email protected]
Proper citation: RRID:RGD_39456107 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429608
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 150429608
Notes: The congenic MWF.SHR-(D6Rat1-D6Rat184)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.
Proper citation: RRID:RGD_150429608 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39456105
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Live Animals; Cryopreserved Embryo (as of 2023-10-24)
Alternate IDs: 39456105
Notes: F344/StmMcwi was redelivered from F344/Stm which was derived from F344/DuCrlj. RGD HRDP, contact Hybrid Rat Diversity program at
[email protected]
Proper citation: RRID:RGD_39456105 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800749
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13800749
Notes: CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13800749 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825199
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13825199
Notes: The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.
Proper citation: RRID:RGD_13825199 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
