SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 57 showing 1121 ~ 1140 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626168271

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryorecovery (as of 2025-08-29)
Alternate IDs: 626168271
Notes: Sprague Dawley rat. Tandem duplication of the genetic interval between Sult1a1 and Spn genes using CRISPR/Cas9 engineering. We targeted the genetic interval borders from one allele and the CRISPR/Cas9 system allowed us to cut and transpose those sequences to the same locus on the second allele. Heterozygous animals are Overweight and hypoactivity. European Mouse Mutant Archive(EMMA)

Proper citation: RRID:RGD_626168271 Copy   


  • RRID:RGD_617154642

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617154642

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 617154642
Notes: The CRISPR/Cas9 genetic editing approach was used to generate .a heterozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines.

Proper citation: RRID:RGD_617154642 Copy   


  • RRID:RGD_156431061

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156431061

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2026-01-15)
Alternate IDs: 156431061
Notes: The CRISPR/Cas9 system was used to introduce a T insertion in exon 1 of C17h6orf52 gene causing a frameshift and predicated early truncation of the translated protein in an embryo from LH/MavRrrcAek (RGD:10755352) through electroporation. Currently live colony with Dr. Anne Kwitek at the Medical College of Wisconsin. Being cryopreserved and the live colony will not be available.

Proper citation: RRID:RGD_156431061 Copy   


  • RRID:RGD_626168261

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626168261

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-08-29)
Alternate IDs: 626168261
Notes: Crispr/Cas9 genome editing of the Peg3 gene The strain is deposit at RRRC - University of Missouri

Proper citation: RRID:RGD_626168261 Copy   


  • RRID:RGD_13506177

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13506177

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2018-01-31)
Alternate IDs: 13506177
Notes: CRISPR/SpCas9 targeting was used to introduce an 11-bp putative frame-shift deletion in exon 3. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13506177 Copy   


  • RRID:RGD_626170595

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626170595

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-02)
Alternate IDs: 626170595
Notes: This allele has a deletion of the C2/GAP domain of Syngap1 and was generated by Sigma Advanced Genetic Engineering (SAGE) Labs (St. Louis, MO, US). Zinc-finger nucleases (ZFNs) designed to target Syngap1 exons 8–12 were microinjected into the pronucleus of fertilized, single-cell Long Evans (LE) embryos. A 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).

Proper citation: RRID:RGD_626170595 Copy   


  • RRID:RGD_632518398

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632518398

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-02-12)
Alternate IDs: 632518398
Notes: The CRISPR/Cas9 system was multiplexed to introduce a double strand brake at exon 3 and 14 to promote the removal of majority of the MPO gene in rat embryos. Animal Modeling Core at the University of Missouri. Availability Contact Email: [email protected]

Proper citation: RRID:RGD_632518398 Copy   


  • RRID:RGD_153297754

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=153297754

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2022-07-21)
Alternate IDs: 153297754
Notes: This strain was produced at the Medical College of Wisconsin using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp indel (rn72: chr4:13,849,488-13,849,492) was identified.

Proper citation: RRID:RGD_153297754 Copy   


  • RRID:RGD_626419679

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626419679

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-09-05)
Alternate IDs: 626419679
Notes: Crl:CD(SD)-KO(Gnal*135)44-178Hpng/Hpng rats were generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. CRISPR technology details: self-synthesized Cas9 mRNA using px 330 vector, applying T7 transcription kit followed by Poly-Adenylation and Capping. No sequencing performed, whether Cas9 has been inserted into the rat genome is unknown. European Mouse Mutant Archive(EMMA)

Proper citation: RRID:RGD_626419679 Copy   


  • RRID:RGD_405100724

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100724

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405100724
Notes: This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. Optogenetics and Transgenic Technology Core

Proper citation: RRID:RGD_405100724 Copy   


  • RRID:RGD_616572761

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616572761

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616572761
Notes: This is the wild type littermate of SD-CdCSem1Bcgen+/- (RGD:616390066). The mutant CdCS rat has the 5p15.2 deletion in the genome and it a rat model for human Cri du Chat Syndrome .

Proper citation: RRID:RGD_616572761 Copy   


  • RRID:RGD_13441560

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13441560

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13441560
Notes: CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos

Proper citation: RRID:RGD_13441560 Copy   


  • RRID:RGD_625777904

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777904

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777904
Notes: To produce Pxr KO rats, A pair of TALEN mRNAs targeting Nr1i2 (Pxr) was injected into rat fertilized eggs.This strain was derived from a founder harbouring a16 bp deletion (rPxr-KO).

Proper citation: RRID:RGD_625777904 Copy   


  • RRID:RGD_625777901

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777901

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777901
Notes: To produce Cyp3a (∼560-kb) KO rats, A pair of TALEN mRNAs targeting exon 5 of rat Cyp3a23/3a1 and Cyp3a2 were injected into rat fertilized eggs. A founder with homozygous big deletion (BD) mutation from No. 58 line selected.

Proper citation: RRID:RGD_625777901 Copy   


  • RRID:RGD_19165366

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165366

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-03-03)
Alternate IDs: 19165366
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062).The homozygous mutant was lethal shortly after birth, so the heterozygous +/- was used for study. Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]

Proper citation: RRID:RGD_19165366 Copy   


  • RRID:RGD_625777902

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777902

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777902
Notes: To produce Cyp3a (∼560-kb) KO rats, A pair of TALEN mRNAs targeting exon 5 of rat Cyp3a23/3a1 and Cyp3a2 were injected into rat fertilized eggs. A founder with 9-bp deletion mutation from No. 65 line selected.

Proper citation: RRID:RGD_625777902 Copy   


  • RRID:RGD_1302639

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1302639

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)
Alternate IDs: 1302639
Notes: Kaken hairless rat were detected by Kimura from Gunn National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_1302639 Copy   


  • RRID:RGD_1358923

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1358923

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 1358923
Notes: A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.

Proper citation: RRID:RGD_1358923 Copy   


  • RRID:RGD_1579690

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1579690

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1579690
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated.

Proper citation: RRID:RGD_1579690 Copy   


  • RRID:RGD_1579677

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1579677

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 1579677
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated.

Proper citation: RRID:RGD_1579677 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X