Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Pde4bem1Sage Resource Report Resource Website |
RRID:RGD_13782128 | Rattus norvegicus | These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. Horizon Discovery | 13782128 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2018-08-22) | 13782128 | 2026-09-12 01:25:35 | 0 | |||||
|
SS-F8em1Mcwi Resource Report Resource Website |
RRID:RGD_13800746 | Rattus norvegicus | CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at [email protected] | 13800746 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-17) | 13800746 | 2026-09-12 01:25:35 | 0 | |||||
|
SD-Fahem10Dlli-/- Resource Report Resource Website |
RRID:RGD_14398828 | Rattus norvegicus | This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates | 14398828 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14398828 | 2026-09-12 01:25:36 | 0 | |||||
|
ACI-Pvt1em2Shul Resource Report Resource Website |
RRID:RGD_150520210 | Rattus norvegicus | Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3. | 150520210 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2021-11-05) | 150520210 | 2026-09-12 01:25:37 | 0 | |||||
|
SS-Mlycdem1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_150520052 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Mlycd gene of SS/JrHsdMcwi rat embryos. This resulted in a global knock-out of the rat Mlycd gene. Please contact: [email protected] | 150520052 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520052 | 2026-09-12 01:25:36 | 1 | |||||
|
F344-Nppcem1Kyo Resource Report Resource Website |
RRID:RGD_127284865 | Rattus norvegicus | This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem1Kyo strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). National BioResource Project for the Rat in Japan | 127284865 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127284865 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Ogdhem1Yuyi Resource Report Resource Website |
RRID:RGD_126925137 | Rattus norvegicus | The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant. | 126925137 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925137 | 2026-09-12 01:25:37 | 0 | |||||
|
F344-Bmpr2em1Sage+/- Resource Report Resource Website |
RRID:RGD_14975305 | Rattus norvegicus | These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency. | 14975305 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14975305 | 2026-09-12 01:25:36 | 0 | |||||
|
WI-Tbc1d4em1Gdcz Resource Report Resource Website |
RRID:RGD_38596327 | Rattus norvegicus | The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) . | 38596327 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38596327 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Csf1rtm(EGFP)+/-/Tset Resource Report Resource Website |
RRID:RGD_126779586 | Rattus norvegicus | Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients | 126779586 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126779586 | 2026-09-12 01:25:37 | 0 | |||||
|
DA-Csf1rtm(EGFP)-/-/Hume Resource Report Resource Website |
RRID:RGD_126779592 | Rattus norvegicus | Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotes | 126779592 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126779592 | 2026-09-12 01:25:37 | 0 | |||||
|
ACI.Cg.-Cdkn1bem1Musc Resource Report Resource Website |
RRID:RGD_126928146 | Rattus norvegicus | The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem1Musc harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletion | 126928146 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126928146 | 2026-09-12 01:25:36 | 0 | |||||
|
LE-Gad1em15Yyan Resource Report Resource Website |
RRID:RGD_149735560 | Rattus norvegicus | Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes. National BioResource Project for the Rat in Japan | 149735560 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-07-22) | 149735560 | 2026-09-12 01:25:37 | 0 | |||||
|
SD-Cpem1Ang+/+ Resource Report Resource Website |
RRID:RGD_38501059 | Rattus norvegicus | The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. | 38501059 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38501059 | 2026-09-12 01:25:36 | 0 | |||||
|
SD-Trpa1em1Gne Resource Report Resource Website |
RRID:RGD_127285810 | Rattus norvegicus | This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified. | 127285810 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127285810 | 2026-09-12 01:25:37 | 0 | |||||
|
SS-P2ry2em5Mcwi Resource Report Resource Website |
RRID:RGD_14394506 | Rattus norvegicus | CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3. Contact MCW rat distribution at [email protected] | 14394506 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-25) | 14394506 | 2026-09-12 01:25:37 | 0 | |||||
|
SHR-Klrb1aem1Mcwi Resource Report Resource Website |
RRID:RGD_14394501 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. Contact MCW rat distribution at [email protected] | 14394501 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-25) | 14394501 | 2026-09-12 01:25:37 | 0 | |||||
|
DA-Tph2em2Mcwi-/- Resource Report Resource Website |
RRID:RGD_14394621 | Rattus norvegicus | The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. | 14394621 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394621 | 2026-09-12 01:25:36 | 0 | |||||
|
SD-Cpem1Ang+/- Resource Report Resource Website |
RRID:RGD_38501060 | Rattus norvegicus | The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. | 38501060 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38501060 | 2026-09-12 01:25:36 | 0 | |||||
|
SD-Cpem1Ang-/- Resource Report Resource Website |
RRID:RGD_38501061 | Rattus norvegicus | The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. | 38501061 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38501061 | 2026-09-12 01:25:36 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
