Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364958
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2024-11-05)
Alternate IDs: 408364958
Notes: The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos
WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG
KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG Rat Resource and Research Center (RRRC); strain ID 1031
Proper citation: RRID:RGD_408364958 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364959
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2024-11-05)
Alternate IDs: 408364959
Notes: The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos
WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG
KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG Rat Resource and Research Center (RRRC); strain ID 1032
Proper citation: RRID:RGD_408364959 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154608
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154608
Notes: "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA.
" National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154608 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407431637
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-08-15)
Alternate IDs: 407431637
Notes: This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Gal. Created by Daniel Davis at University of Missouri. Deposited at RRRC. Deposited at RRRC. Contact [email protected] for availability.
Proper citation: RRID:RGD_407431637 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154600
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-04-30)
Alternate IDs: 598154600
Notes: This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 410 bp deletion in the Rag2 gene was established from the resulting litters. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154600 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407450414
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 407450414
Notes: The wild type rats were littermates of cross of heterozygous Il6 mutant rats. The wild type littermates were used as experimental controls for the homozygous mutant SD-Il6em1Yona-/- (RGD:407450413) generated using the CRISPR/Cas9 technique to induce a 118 bp deletion in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan
Proper citation: RRID:RGD_407450414 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407431636
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-08-15)
Alternate IDs: 407431636
Notes: This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Drd3. Deposited at RRRC. Contact [email protected] for availability.
Proper citation: RRID:RGD_407431636 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407431635
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-08-15)
Alternate IDs: 407431635
Notes: CRISPR/Cas9 was used to insert CRE recombinase at DRD3 in rat embryos.This is line2, and line1 is "LE-DRD3em1(cre)Davis" (RGD:407431632). Both are created by Daniel Davis at University of Missouri for the Section on Behavioral Neuroscience at NIMH. Deposited at RRRC. Contact [email protected] for availability.
Proper citation: RRID:RGD_407431635 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165362
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 19165362
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/NCrl rat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene, which led to a frameshift mutation and early termination of the KRTCAP3 protein. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_19165362 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=639699398
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 639699398
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062).The homozygous mutant was lethal shortly after birth, so the heterozygous +/- (RGD:19165366) was used for breeding and study. Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]
Proper citation: RRID:RGD_639699398 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849114
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 329849114
Notes: The CRISPR/SpCas9 system was used to introduce a 10-bp deletion (rn6: chr3:153,453,801-153,453,810) in exon 3 of the Ghrh gene in Crl:SD Sprague Dawley embryos.
Proper citation: RRID:RGD_329849114 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632518357
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2026-02-06)
Alternate IDs: 632518357
Notes: The endonuclease mediated knock in of the transgenic cassette, CAG-LSL-tdTomato in mouse (ROSA)26Sor, was created in Crl:CD (SD) rats. Cyagen
Proper citation: RRID:RGD_632518357 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629006637
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 629006637
Notes: ANTXR2 knock-out rats were generated using CRISPR/Cas9-mediated genome editing. Specifically, a 67 base pairs deletion in exon 1 of ANTXR2 was induced by 2 guide RNAs targeting sequences within exon 1. The guide RNA targeting vectors and Cas9 were co-injected into the fertilized Sprague Dawley eggs to generate ANTXR2 knock-out rats. The pups were genotyped by PCR and confirmed by sequencing (forward primer: 5′-TTGGGTGGCTCTGAGCTTGGA-3′, reverse primer: 5′-AGGGGTCTAGGGGAGTGTGATAAAGA-3′).
Proper citation: RRID:RGD_629006637 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394534
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 25394534
Notes: LE-ROSA26em1(CAG-tdTomato)1Sage (RGDID: 12905037) was backcrossed to SS/JrHsdMcwi for more than 8 generations. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_25394534 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152998996
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2022-07-15)
Alternate IDs: 152998996
Notes: This model was generated at the Medical College of Wisconsin by CRISPR/Cas9 mutagenesis in Crl:SD strain and harbors a 16-bp deletion in exon 3 of Adh5. rn6.0:chr2:226,979,096-226,979,111. contact MCW Rat Distribution at [email protected]
Proper citation: RRID:RGD_152998996 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152998993
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2022-07-15)
Alternate IDs: 152998993
Notes: This model was produced at the Medical College of Wisconsin using CRISPR/Cas9 in the Crl:SD strain. The resulting mutation is a 1-bp insertion in the third exon of the Ager gene. rn6.0:chr20:4,150,403-4,150,403 ins T contact MCW Rat Distribution at [email protected]
Proper citation: RRID:RGD_152998993 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632645231
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 632645231
Notes: This is a heterozygous Galt mutant rat carries one copy of CRISPR/Cas9 system induced 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos.
Proper citation: RRID:RGD_632645231 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777899
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 625777899
Notes: To produce Ugt2 cluster (∼762-kb) KO rats, two gRNAs with target sites upstream of Ugt2a1 and the coding region of Ugt2b31-like were injected into rat fertilized eggs.
A knockout strain with Ugt2 cluster mutation carried concatenation of the genomic sequence upstream of Ugt2a1, a 102-bp insertion, and the Ugt2b31-like region.
The F2 homozygous rats showed decreased gemfibrozil glucuronidation activity in the liver.
The result suggested the functional deletion of rat Ugt2 genes in the Ugt2-KO rats.
Proper citation: RRID:RGD_625777899 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626170603
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2025-09-02)
Alternate IDs: 626170603
Notes: In collaboration with Horizon Discovery, CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).
Proper citation: RRID:RGD_626170603 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617154644
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 617154644
Notes: The CRISPR/Cas9 genetic editing approach was used to generate .a homozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines.
Proper citation: RRID:RGD_617154644 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.