Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 56 showing 1101 ~ 1120 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_10054310

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054310

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054310
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054310 Copy   


  • RRID:RGD_10413850

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413850

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413850
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413850 Copy   


  • RRID:RGD_8552259

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552259

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo
Alternate IDs: 8552259
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552259 Copy   


  • RRID:RGD_10413854

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413854

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413854
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413854 Copy   


  • RRID:RGD_10054439

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054439

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054439
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054439 Copy   


  • RRID:RGD_10045600

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045600

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10045600
Notes: Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_10045600 Copy   


  • RRID:RGD_10054242

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054242

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2016-10-24)
Alternate IDs: 10054242
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054242 Copy   


  • RRID:RGD_8552261

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552261

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2023-03-07)
Alternate IDs: 8552261
Notes: Developed by the DEPOSITOR. This congenic strain was established by backcrossing MPR/Iar (RGD:2306064) (provided by Dr. Kunieda, Okayama University) to WIAR/Iar (RGD:2304222) National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_8552261 Copy   


  • RRID:RGD_10054245

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054245

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054245
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054245 Copy   


  • RRID:RGD_10054411

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054411

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054411
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054411 Copy   


  • RRID:RGD_10053601

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053601

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10053601
Notes: Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN

Proper citation: RRID:RGD_10053601 Copy   


  • RRID:RGD_10054465

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054465

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10054465
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054465 Copy   


  • RRID:RGD_10045593

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045593

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2016-12-08)
Alternate IDs: 10045593
Notes: By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_10045593 Copy   


  • RRID:RGD_10045597

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045597

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10045597
Notes: Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_10045597 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401848

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10401848
Notes: ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.

Proper citation: RRID:RGD_10401848 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11531104

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11531104
Notes: The heterozygous ZFN mutant rats were produced by backcrossing mutant founders with iNP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2.

Proper citation: RRID:RGD_11531104 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11531106

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11531106
Notes: The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (iNP-Npyem6Sage+/- /Iusm) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2.

Proper citation: RRID:RGD_11531106 Copy   


  • RRID:RGD_10054239

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054239

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054239
Notes: CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054239 Copy   


  • RRID:RGD_9835401

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=9835401

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 9835401
Notes: The Zucker rats from Charles River (ZDF-Leprfa/Crl) carry the Leprm1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269

Proper citation: RRID:RGD_9835401 Copy   


  • RRID:RGD_11531094

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11531094

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11531094
Notes: These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat F8 into Sprague Dawley embryos. A premature translation stop in rat F8 was created in the mutant founders carrying a 13-bp deletion in exon 16. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.

Proper citation: RRID:RGD_11531094 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X