Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00055417
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; C16C10.8(ve767[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III.
Notes: Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval lethal or sterile. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 larvae (ve767 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atggtgtttcatgagaaatgtggctctccc ; Right flanking sequence: TTGACAATCAATACAGCTGAAAGTAGTATT. sgRNA #1: tgaactcacacaatttcacc; sgRNA #2: CTTGTCTACACgtaagcttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055417 Copy
http://www.wormbase.org/db/get?name=WBStrain00055419
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: RG KO Group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055419 Copy
http://www.wormbase.org/db/get?name=WBStrain00055455
Source Database: WormBase (WB)
Affected Genes: WBGene00002078(xpo-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002078(xpo-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1[umnIs49] IV; xpo-1(ve807[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055455 Copy
http://www.wormbase.org/db/get?name=WBStrain00055450
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: K10H10.6(ve802[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttggctagagtcaacccaacgctccgccc ; Right flanking sequence: CCGCGCCGTCCAGAATTGTAATACTTTCTT. sgRNA #1: tcgaaaagagggaggtgagt; sgRNA #2: AGAGTCGAACCACTGGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055450 Copy
http://www.wormbase.org/db/get?name=WBStrain00055457
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00043705(egrh-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00043705(egrh-2)
Availability: unknown
Source References: EMPTY
Synonyms: egrh-2(ve809[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 5538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCTATCGGTTCGCAAATGTCATTACCG ; Right flanking sequence: cccACTTTTAATCTGAAATTTTGTATAAAA. sgRNA #1: GTGTGTCGGAGGAAGAAACA; sgRNA #2: aaattgctttaatgcctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055457 Copy
http://www.wormbase.org/db/get?name=WBStrain00055443
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y53G8AL.1(ve795[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 6742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGGAGAACGACTATTGGAAGTGCTCCG ; Right flanking sequence: cggaatcggaaaattcagaaaatttcagtt. sgRNA #1: TTGAGCACCACATCACAGGT; sgRNA #2: aaatcatgttacagctgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055443 Copy
http://www.wormbase.org/db/get?name=WBStrain00055441
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F49C12.11(ve792[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGGCAAAGCCACTGAAGGCCGCAAAAAA ; Right flanking sequence: cggtcaaatattatgccatctcatccgcaa. sgRNA #1: AACGGAGAAGGATCTTTCTG; sgRNA #2: CAGGAAAGAAGTAAttgcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055441 Copy
http://www.wormbase.org/db/get?name=WBStrain00055448
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: npl-4.2(ve800[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1752 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAAAATCTATTTTATTTCAGATATGGTA ; Right flanking sequence: ACATTCCAAAACGAAGCAGGAAGACAGGAT. sgRNA #1: CGTTGACACGCTCAGTTTGA; sgRNA #2: ACAGTGTCCACAGCTCCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055448 Copy
http://www.wormbase.org/db/get?name=WBStrain00055439
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004389(rnp-6)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004389(rnp-6), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I.
Notes: Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055439 Copy
http://www.wormbase.org/db/get?name=WBStrain00055498
Source Database: WormBase (WB)
Affected Genes: WBGene00001080(dpy-21)|WBGene00003514(myo-2)|WBGene00004452(rpl-38)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001080(dpy-21), WBGene00003514(myo-2), WBGene00004452(rpl-38), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V.
Notes: Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+.May grow better at 15C. Left flanking Sequence: CTCTCGAAAGCAGAATTAAATTCGTTTAGA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055498 Copy
http://www.wormbase.org/db/get?name=WBStrain00055531
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; C36A4.4(gk5562[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055531 Copy
http://www.wormbase.org/db/get?name=WBStrain00055497
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: veDf3 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] V.
Notes: Homozygous viable. Deletion of 4002 bp removes his-8, his-7, his-6, his-5, and his-39, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGTGATTTGCTTTCAGCAATTGAATGC ; Right flanking sequence: GCATTCAATTGCTGAAAGCAAATCACCGAA. his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG; his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055497 Copy
http://www.wormbase.org/db/get?name=WBStrain00055530
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; C35D10.5(gk5552[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055530 Copy
http://www.wormbase.org/db/get?name=WBStrain00055533
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009440(idhg-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009440(idhg-1)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055533 Copy
http://www.wormbase.org/db/get?name=WBStrain00055499
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C46H3.2(ve856[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 6859 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCTAAAACATTTCAATTCTAACCTTGCA ; Right flanking sequence: TGCTTCAACACCACAAAAGTCCTCAACTGC. C46H3.2 sgRNA #1: TGATCATCGGATAACAATGG; C46H3.2 sgRNA #2: AACGAGCTGAGCTTATCGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055499 Copy
http://www.wormbase.org/db/get?name=WBStrain00055532
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008002(nlp-48)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008002(nlp-48)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055532 Copy
http://www.wormbase.org/db/get?name=WBStrain00055493
Source Database: WormBase (WB)
Affected Genes: WBGene00000180(arc-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000180(arc-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: arc-1(ve850[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 2121 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAGCAAATGTTTCAGTTAATGAATGAATA ; Right flanking sequence: GCCCTGTATAGTTTTCTGTCGGAATTTATA. arc-1 sgRNA #1: TGGTTGCAACGTGTGCAACG; arc-1 sgRNA #2: ATGTACCATTAAGACGACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055493 Copy
http://www.wormbase.org/db/get?name=WBStrain00055535
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II.
Notes: umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Proper citation: RRID:WB-STRAIN:WBStrain00055535 Copy
http://www.wormbase.org/db/get?name=WBStrain00055520
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; Y37D8A.16(gk5539[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5539 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4466 and CGC66. gk5539 is a 2739 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGCAATTATAAGATCCCTTCGAGATA; Right flanking sequence: GTATACAGTTCCGGTGCATGACTAATGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00055520 Copy
http://www.wormbase.org/db/get?name=WBStrain00055489
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C25E10.5(ve846[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTGATCATTGTCGCTGGAATAGTTTCCG ; Right flanking sequence: TGGCTCATCAAATCATCCGTTTTCTTCGCA. C25E10.5 sgRNA #1: ATTTTCCACGGCATTCAATG; C25E10.5 sgRNA #2: TAGTGGTCCAACTCCCAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00055489 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.