Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00035580
Source Database: WormBase (WB)
Affected Genes: WBGene00006405(itsn-1)
Genomic Alteration: WBGene00006405(itsn-1)
Availability: available
Source References: PMID:37053235
Synonyms: itsn-1(ok268) IV.
Alternate IDs: WB-STRAIN:VC201, CGC_VC201
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.36. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00035580 Copy
http://www.wormbase.org/db/get?name=WBStrain00035581
Source Database: WormBase (WB)
Affected Genes: WBGene00000103(akt-2)
Genomic Alteration: WBGene00000103(akt-2)
Availability: available
Source References: PMID:33471780, PMID:37885348
Synonyms: akt-2(ok393) X.
Alternate IDs: WB-STRAIN:VC204, CGC_VC204
Notes: F28H6.1. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype akt-2(ok393)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00035581 Copy
http://www.wormbase.org/db/get?name=WBStrain00035547
Source Database: WormBase (WB)
Affected Genes: WBGene00006614(trp-1)
Genomic Alteration: WBGene00006614(trp-1)
Availability: available
Source References: EMPTY
Synonyms: trp-1(ok323) III.
Alternate IDs: WB-STRAIN:VC160, CGC_VC160
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC21.2. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00035547 Copy
http://www.wormbase.org/db/get?name=WBStrain00035540
Source Database: WormBase (WB)
Affected Genes: WBGene00001251(elt-3)
Genomic Alteration: WBGene00001251(elt-3)
Availability: available
Source References: EMPTY
Synonyms: elt-3(gk122) X.
Alternate IDs: WB-STRAIN:VC144, CGC_VC144
Notes: K02B9.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035540 Copy
http://www.wormbase.org/db/get?name=WBStrain00035555
Source Database: WormBase (WB)
Affected Genes: WBGene00000516(cki-1)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000516(cki-1), WBGene00001072(dpy-10)
Availability: available
Source References: PMID:38522217
Synonyms: cki-1(gk132)/mIn1 II
Alternate IDs: WB-STRAIN:VC170, CGC_VC170
Notes: Mutagen:UV/TMP|"T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035555 Copy
http://www.wormbase.org/db/get?name=WBStrain00035557
Source Database: WormBase (WB)
Affected Genes: WBGene00000467(cep-1)
Genomic Alteration: WBGene00000467(cep-1)
Availability: available
Source References: PMID:31704915, PMID:33262405
Synonyms: cep-1(gk138) I.
Alternate IDs: WB-STRAIN:VC172, CGC_VC172
Notes: F52B5.5. Superficially wild type.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060693 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035557 Copy
http://www.wormbase.org/db/get?name=WBStrain00035556
Source Database: WormBase (WB)
Affected Genes: WBGene00004877(smf-2)
Genomic Alteration: WBGene00004877(smf-2)
Availability: available
Source References: EMPTY
Synonyms: smf-2(gk133) X.
Alternate IDs: WB-STRAIN:VC171, CGC_VC171
Notes: K11G12.3. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035556 Copy
http://www.wormbase.org/db/get?name=WBStrain00035560
Source Database: WormBase (WB)
Affected Genes: WBGene00004933(sod-4)
Genomic Alteration: WBGene00004933(sod-4)
Availability: available
Source References: EMPTY
Synonyms: sod-4(gk101) III.
Alternate IDs: WB-STRAIN:VC175, CGC_VC175
Notes: F55H2.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035560 Copy
http://www.wormbase.org/db/get?name=WBStrain00035522
Source Database: WormBase (WB)
Affected Genes: WBGene00006475(tyra-3)
Genomic Alteration: WBGene00006475(tyra-3)
Availability: available
Source References: PMID:32847964, PMID:37728328, PMID:37773959
Synonyms: tyra-3(ok325) X.
Alternate IDs: WB-STRAIN:VC125, CGC_VC125
Notes: M03F4.3. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype tyra-3(ok325)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00035522 Copy
http://www.wormbase.org/db/get?name=WBStrain00035537
Source Database: WormBase (WB)
Affected Genes: WBGene00006977(zif-1)
Genomic Alteration: WBGene00006977(zif-1)
Availability: available
Source References: EMPTY
Synonyms: zif-1(gk117) III.
Alternate IDs: WB-STRAIN:VC141, CGC_VC141
Notes: F59B2.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035537 Copy
http://www.wormbase.org/db/get?name=WBStrain00035534
Source Database: WormBase (WB)
Affected Genes: WBGene00001239(elo-1)
Genomic Alteration: WBGene00001239(elo-1)
Availability: available
Source References: EMPTY
Synonyms: elo-1(gk48) IV.
Alternate IDs: WB-STRAIN:VC138, CGC_VC138
Notes: F56H1.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035534 Copy
http://www.wormbase.org/db/get?name=WBStrain00035584
Source Database: WormBase (WB)
Affected Genes: WBGene00000391(cdd-1)
Genomic Alteration: WBGene00000391(cdd-1)
Availability: available
Source References: PMID:32049015
Synonyms: cdd-1(ok390) X.
Alternate IDs: WB-STRAIN:VC208, CGC_VC208
Notes: C47D2.2. Superficially wild type.|"Mutagen:UV/TMP"|"Reference WBPaper00059294 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035584 Copy
http://www.wormbase.org/db/get?name=WBStrain00035593
Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36)
Genomic Alteration: WBGene00000553(cmk-1), WBGene00044213(Y102A5C.36)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V.
Alternate IDs: WB-STRAIN:VC220, CGC_VC220
Notes: Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035593 Copy
http://www.wormbase.org/db/get?name=WBStrain00035519
Source Database: WormBase (WB)
Affected Genes: WBGene00006876(vab-10)
Genomic Alteration: WBGene00006876(vab-10)
Availability: available
Source References: PMID:38177158, PMID:38302462
Synonyms: vab-10(gk45) I.
Alternate IDs: WB-STRAIN:VC117, CGC_VC117
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1151.1a. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00035519 Copy
http://www.wormbase.org/db/get?name=WBStrain00035598
Source Database: WormBase (WB)
Affected Genes: WBGene00002048(ida-1)
Genomic Alteration: WBGene00002048(ida-1)
Availability: available
Source References: EMPTY
Synonyms: ida-1(ok409) III.
Alternate IDs: WB-STRAIN:VC226, CGC_VC226
Notes: B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035598 Copy
http://www.wormbase.org/db/get?name=WBStrain00035602
Source Database: WormBase (WB)
Affected Genes: WBGene00001687(gpn-1)
Genomic Alteration: WBGene00001687(gpn-1)
Availability: available
Source References: PMID:38177158
Synonyms: gpn-1(ok377) X.
Alternate IDs: WB-STRAIN:VC233, CGC_VC233
Notes: F59D12.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035602 Copy
http://www.wormbase.org/db/get?name=WBStrain00035605
Source Database: WormBase (WB)
Affected Genes: WBGene00001309(emr-1)
Genomic Alteration: WBGene00001309(emr-1)
Availability: available
Source References: EMPTY
Synonyms: emr-1(gk119) I.
Alternate IDs: WB-STRAIN:VC237, CGC_VC237
Notes: M01D7.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035605 Copy
http://www.wormbase.org/db/get?name=WBStrain00035687
Source Database: WormBase (WB)
Affected Genes: WBGene00002043(hyl-1)
Genomic Alteration: WBGene00002043(hyl-1)
Availability: available
Source References: EMPTY
Synonyms: hyl-1(gk203) IV.
Alternate IDs: WB-STRAIN:VC334, CGC_VC334
Notes: C09G4.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035687 Copy
http://www.wormbase.org/db/get?name=WBStrain00035616
Source Database: WormBase (WB)
Affected Genes: WBGene00000373(cyp-14A5)
Genomic Alteration: WBGene00000373(cyp-14A5)
Availability: available
Source References: EMPTY
Synonyms: cyp-14A5(gk152) V.
Alternate IDs: WB-STRAIN:VC249, CGC_VC249
Notes: F08F3.7. Superficially wild type, mildly Him, some progeny sterile.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035616 Copy
http://www.wormbase.org/db/get?name=WBStrain00035694
Source Database: WormBase (WB)
Affected Genes: WBGene00006448(glod-4)
Genomic Alteration: WBGene00006448(glod-4)
Availability: available
Source References: PMID:37728328
Synonyms: glod-4(gk189) III.
Alternate IDs: WB-STRAIN:VC343, CGC_VC343
Notes: C16C10.10. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype glod-4(gk189)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035694 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.