Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 55 showing 1081 ~ 1100 out of 1,466 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00055483

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010558(ptrg-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010558(ptrg-1)
Availability: unknown
Source References: EMPTY
Synonyms: ptrg-1(ve839[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 3983 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATTTTCACCTTCGAGGCAAAAATACCA ; Right flanking sequence: GAACTGAAACTGAAAATCGAAGAATTGGTC. ptp-4 sgRNA #1: TCGTATACCGAAATTCAGTG; ptp-4 sgRNA #2: GCACCGTTTCTGATAACACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 3983 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATTTTCACCTTCGAGGCAAAAATACCA ; Right flanking sequence: GAACTGAAACTGAAAATCGAAGAATTGGTC. ptp-4 sgRNA #1: TCGTATACCGAAATTCAGTG; ptp-4 sgRNA #2: GCACCGTTTCTGATAACACA. ptrg-1 formerly known as ptp-4. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055483 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055482

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C25G4.2(ve838[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCTCTCTCATAAATCCGGCAATCTTCTCCT ; Right flanking sequence: AGGCAGAGGATCCGGAGTTTCGGTTGGGAA. C25G4.2 sgRNA #1: ACCGTCGATGTCAAAGCACA; C25G4.2 sgRNA #2: CGCATTGTCGATATCCGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055482 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055527

Source Database: WormBase (WB)
Affected Genes: WBGene00002152(iars-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002152(iars-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: iars-1(gk5827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ nT1 [umnIs49] IV; +/ nT1 V
Notes: Made_by: Morgan Zaic|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055527 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055524

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002238(kars-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002238(kars-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055524 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055525

Source Database: WormBase (WB)
Affected Genes: WBGene00001580(gex-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001580(gex-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/ nT1 V
Notes: Made_by: Morgan Zaic|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055525 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055492

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: R03H10.7(ve849[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAGATGTATAATACAATGGTGTTGAAG ; Right flanking sequence: TAAATCGAGATTTTAATGAAATTATTACAT. R03H10.7 sgRNA #1: TTATGTTGGAATTTGACTGA; R03H10.7 sgRNA #2: CAGTTCTGCTATGTGCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055492 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055491

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010699(trpp-6)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010699(trpp-6)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1 [umnIs49] IV; trpp-6(ve848[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CGGAGCCCTTGCTGGTCTTAATATTAGAGT. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055491 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055476

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C16C8.18(ve830[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCGAAAATCGGAAGAAAAAGTTCAACGAT ; Right flanking sequence: AAGCTGAAGTCTGTGAAGATTTGATAACTC. sgRNA #1: GATGAGCAGTAGTATCGAAG; sgRNA #2: CTTCTCGAGCAAAAGAGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055476 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055478

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004821(skr-15)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004821(skr-15), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: skr-15(ve834[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 474 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTGCTGCTCCAATCGCCGAAGAAGCCA ; Right flanking sequence: AGGCATCTGCAACTTCTGCTGATACAACTG. sgRNA #1: GCTGTAGTAGACGACTGGGG; sgRNA #2: GTTTGGCAAGGAGAAGACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055478 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055510

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00077696(marc-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00077696(marc-1)
Availability: unknown
Source References: EMPTY
Synonyms: marc-1(ve868[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGGCAAGCACACAGGTTCAATCACCAG ; Right flanking sequence: ACACTCTGATTGCTCAATTCATTCGCTACT. marc-1 sgRNA #1: AGAAACCAGTGAGACCGGCA; marc-1 sgRNA #2: ATACGTTGTTGAGAATTGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055510 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055472

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK353.9(ve826[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 2281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGCAGAGCACATTCCAGAAGTTCCAGGTGA ; Right flanking sequence: GGGACTTTTCTAAaataattaattattgat. sgRNA #1: TATCGTAGCGATACACGTCA; sgRNA #2: ATTCCAGATGCTGTTGCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055472 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055474

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018572(lin-42)|WBGene00021073(nsun-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018572(lin-42), WBGene00021073(nsun-1)
Availability: unknown
Source References: EMPTY
Synonyms: nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II.
Notes: Made_by: RG KO Group|"tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+.Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055474 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055473

Source Database: WormBase (WB)
Affected Genes: WBGene00001080(dpy-21)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001080(dpy-21), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V.
Notes: Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055473 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055517

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F36D4.5(ve877[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ; Right flanking sequence: . ?: ?; ?: ?. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCTTCGACTCACCATTCAGCGATCGAACC; Right flanking sequence: CCCATCACATCCATTGTGCTAGTGGGCGAG. F36D4.5 sgRNA A: AGAAGCAACTGAGAAACTAG F36D4.5 sgRNA B: AACAGCCAGAAGAAAAACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055517 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055516

Source Database: WormBase (WB)
Affected Genes: WBGene00002036(hum-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002036(hum-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: hum-2(ve876[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 12,034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCAGCATTGAAGCACGTGTGTTGGCGAGC ; Right flanking sequence: TGGTGATGATATTGTTGTGAAGCAGGTAAT. hum-2 sgRNA A: AATCCGATTATGGAGTCGAT; hum-2 sgRNA B: ACAAAACTGACGACTTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055516 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055518

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001661(gop-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001661(gop-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/mT1 [umnIs52] II; gop-2(gk5528[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III.
Notes: Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055518 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055513

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: R04B5.6(ve871[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 1096 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTCTCAAGATAATTTGTCTGCTGTCCT ; Right flanking sequence: AGGAGTTGTTGTTCTAGTTGGATTGGGTGC. R04B5.6 sgRNA #1: GTAAATCGTTTATTCCGTAG; R04B5.6 sgRNA #2: TTGTAGACAACAAGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055513 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055479

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017550(nep-6)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017550(nep-6)
Availability: unknown
Source References: EMPTY
Synonyms: nep-6(ve835[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 3709 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTCTGCGAAAGATAAGCTGGCCAATCCT ; Right flanking sequence: ATATGCCACAATTTGCGACAGCATTCAACT. nep-6 sgRNA #1: AACACGACTAGAGCAATCAG; nep-6 sgRNA #2: TGGAAAAGATCCCATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055479 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055512

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00023410(clpr-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00023410(clpr-2)
Availability: unknown
Source References: EMPTY
Synonyms: clpr-2(ve870[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATGGAGAATGGAAAGTGATTAAAATTGA ; Right flanking sequence: CGGAACAATTGAGAAATAGGGTGAATTTGT. clpr-2 sgRNA #1: TTTTCACGTTCCAAGCTCGT; clpr-2 sgRNA #2: AGAAGCGCTAAGATTAGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055512 Copy   

http://www.wormbase.org/db/get?name=WBStrain00055515

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1320.7(ve875[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 520 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATGCAAGCTTCTTCTCGAGCACGGAGCCG ; Right flanking sequence: AGGTGCCAACTACGAAGAAGGACATAATTA. ZK1320.7 sgRNA A: TGAGTCTCGGACACCCGGAT; ZK1320.7 sgRNA B: TAAAAACCTGAAAGTTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055515 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch